Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604356746:

Variant ID: vg0604356746 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4356746
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCTTATTCAAAAAATTTTAGAATTATTATTTATTTTTTTTACTTACTTTATTATCCAAAGTACTTTAAGCATAACTTTTCGTTTTTTATATTTGCATAA[T/A]
TTTTTTTAATAAGACGAGTGGTCAAACACTATAAGTAAAAACTCAAAATCTCTTATATTATGGGACGGAGGGAGTACTAGAGTAATTACTAGCTATAAGT

Reverse complement sequence

ACTTATAGCTAGTAATTACTCTAGTACTCCCTCCGTCCCATAATATAAGAGATTTTGAGTTTTTACTTATAGTGTTTGACCACTCGTCTTATTAAAAAAA[A/T]
TTATGCAAATATAAAAAACGAAAAGTTATGCTTAAAGTACTTTGGATAATAAAGTAAGTAAAAAAAATAAATAATAATTCTAAAATTTTTTGAATAAGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	13.70%	7.60%	0.40%	78.31%	NA
All Indica	2759	2.00%	0.50%	0.51%	96.96%	NA
All Japonica	1512	37.00%	22.10%	0.00%	40.94%	NA
Aus	269	9.30%	0.00%	0.74%	89.96%	NA
Indica I	595	3.00%	0.20%	1.01%	95.80%	NA
Indica II	465	2.40%	2.40%	0.65%	94.62%	NA
Indica III	913	0.40%	0.10%	0.00%	99.45%	NA
Indica Intermediate	786	2.80%	0.30%	0.64%	96.31%	NA
Temperate Japonica	767	62.80%	32.70%	0.00%	4.43%	NA
Tropical Japonica	504	3.60%	6.20%	0.00%	90.28%	NA
Japonica Intermediate	241	24.50%	21.60%	0.00%	53.94%	NA
VI/Aromatic	96	0.00%	6.20%	0.00%	93.75%	NA
Intermediate	90	7.80%	5.60%	3.33%	83.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604356746	T -> A	LOC_Os06g08720.1	upstream_gene_variant ; 3362.0bp to feature; MODIFIER	silent_mutation	Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N
vg0604356746	T -> A	LOC_Os06g08720.2	upstream_gene_variant ; 3362.0bp to feature; MODIFIER	silent_mutation	Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N
vg0604356746	T -> A	LOC_Os06g08720.3	upstream_gene_variant ; 3362.0bp to feature; MODIFIER	silent_mutation	Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N
vg0604356746	T -> A	LOC_Os06g08720-LOC_Os06g08730	intergenic_region ; MODIFIER	silent_mutation	Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N
vg0604356746	T -> DEL	N	N	silent_mutation	Average:42.378; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604356746	NA	2.29E-19	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604356746	NA	7.12E-13	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604356746	4.28E-12	NA	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746	1.99E-11	4.22E-09	mr1137	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746	2.55E-10	NA	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746	1.03E-09	9.67E-09	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746	1.19E-13	NA	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746	1.72E-11	9.91E-11	mr1137_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746	1.63E-07	NA	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746	6.77E-07	1.90E-07	mr1617_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604356746	NA	1.17E-06	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251