Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604350087:

Variant ID: vg0604350087 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4350087
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCAGTAGCCTGTATGTTTGATCAGAAATCAAGCCATTGGTCCACATGAATTGAAATATGCCAAGGTGATCGTGGAAATCATCGAACAGAGCATTTCCT[G/A]
CCTGCAAAAACATGTCATTACATACAAAGAAAATAAATTAAATAATACAGTTCCTGGGAAAATGGCATGTTCGAAATGAGAATATATGTATTACGAGGTG

Reverse complement sequence

CACCTCGTAATACATATATTCTCATTTCGAACATGCCATTTTCCCAGGAACTGTATTATTTAATTTATTTTCTTTGTATGTAATGACATGTTTTTGCAGG[C/T]
AGGAAATGCTCTGTTCGATGATTTCCACGATCACCTTGGCATATTTCAATTCATGTGGACCAATGGCTTGATTTCTGATCAAACATACAGGCTACTGAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.00% 12.00% 0.04% 0.00% NA
All Indica  2759 99.60% 0.40% 0.04% 0.00% NA
All Japonica  1512 63.50% 36.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 1.00% 0.13% 0.00% NA
Temperate Japonica  767 37.50% 62.50% 0.00% 0.00% NA
Tropical Japonica  504 97.00% 3.00% 0.00% 0.00% NA
Japonica Intermediate  241 75.90% 24.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604350087 G -> A LOC_Os06g08720.1 missense_variant&splice_region_variant ; p.Ala229Val; MODERATE nonsynonymous_codon ; A229V Average:27.876; most accessible tissue: Callus, score: 48.929 benign -1.069 TOLERATED 1.00
vg0604350087 G -> A LOC_Os06g08720.2 missense_variant&splice_region_variant ; p.Ala229Val; MODERATE nonsynonymous_codon ; A229V Average:27.876; most accessible tissue: Callus, score: 48.929 benign -1.069 TOLERATED 1.00
vg0604350087 G -> A LOC_Os06g08720.3 missense_variant&splice_region_variant ; p.Ala229Val; MODERATE nonsynonymous_codon ; A229V Average:27.876; most accessible tissue: Callus, score: 48.929 benign -1.069 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604350087 7.83E-08 NA Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604350087 3.11E-16 1.91E-36 mr1115 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 1.01E-10 1.56E-21 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 2.11E-37 1.10E-73 mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 8.35E-22 7.10E-36 mr1137 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 NA 1.17E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 NA 4.37E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 NA 1.98E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 NA 6.20E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 NA 3.33E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 6.39E-10 3.21E-29 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 7.61E-07 4.60E-15 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 5.55E-30 2.44E-58 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 8.93E-18 1.43E-26 mr1617 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 2.73E-13 6.58E-32 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 2.08E-08 2.28E-15 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 NA 8.90E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 7.02E-15 9.52E-37 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 4.98E-10 7.86E-20 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 2.63E-40 1.23E-79 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 8.32E-21 3.76E-33 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 1.86E-08 NA mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 8.11E-10 1.93E-29 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 2.10E-07 2.38E-15 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 7.82E-19 4.29E-45 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604350087 2.64E-10 9.84E-17 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251