Variant ID: vg0429950476 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 29950476 |
Reference Allele: C | Alternative Allele: A |
Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )
GTTGGCGATGACCCACCGGTTGCTTGCGTCAGTGCTGGTGGTGTTCGGTTGTGCGTTCCTGGCGAGGGAGCAGCAGCGACCTTCTCCGTTGCTTCGTGGG[C/A]
CGGCGTCTTGAAGATGGGCTGACGTGGTGAGACCGAACTATAACGCGTGTAGGGGTCATGAAGACAAAAACAAATAGTATGAGTGGAGGAAAGAGGAACA
TGTTCCTCTTTCCTCCACTCATACTATTTGTTTTTGTCTTCATGACCCCTACACGCGTTATAGTTCGGTCTCACCACGTCAGCCCATCTTCAAGACGCCG[G/T]
CCCACGAAGCAACGGAGAAGGTCGCTGCTGCTCCCTCGCCAGGAACGCACAACCGAACACCACCAGCACTGACGCAAGCAACCGGTGGGTCATCGCCAAC
Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 90.70% | 6.00% | 3.32% | 0.00% | NA |
All Indica | 2759 | 94.50% | 2.10% | 3.48% | 0.00% | NA |
All Japonica | 1512 | 82.10% | 14.20% | 3.77% | 0.00% | NA |
Aus | 269 | 98.10% | 0.40% | 1.49% | 0.00% | NA |
Indica I | 595 | 86.70% | 3.90% | 9.41% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
Indica III | 913 | 99.60% | 0.10% | 0.33% | 0.00% | NA |
Indica Intermediate | 786 | 91.30% | 4.20% | 4.45% | 0.00% | NA |
Temperate Japonica | 767 | 66.50% | 26.50% | 7.04% | 0.00% | NA |
Tropical Japonica | 504 | 99.00% | 0.60% | 0.40% | 0.00% | NA |
Japonica Intermediate | 241 | 96.30% | 3.30% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0429950476 | C -> A | LOC_Os04g50192.1 | missense_variant ; p.Ala60Ser; MODERATE | nonsynonymous_codon ; A60S | Average:66.374; most accessible tissue: Zhenshan97 young leaf, score: 78.044 | unknown | unknown | TOLERATED | 0.36 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0429950476 | 8.64E-06 | 1.37E-20 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0429950476 | 1.07E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0429950476 | 4.67E-06 | 4.67E-06 | mr1166_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0429950476 | NA | 9.34E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0429950476 | NA | 1.26E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0429950476 | NA | 6.86E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0429950476 | NA | 6.35E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0429950476 | NA | 3.11E-06 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |