Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418762497:

Variant ID: vg0418762497 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18762497
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTTCTTAATATTCTTTCCATTTTTTTACCCTCATGCAACCATATTTCTATATTATAGTGATCAAGAGCGGATGAGGCTAATGGGTGGGTGATCGCTGG[A/G]
AGCGATCAACCCGCCCCTCCCCCTATACTCCTTTCCCTTCTTTCCTTTCATCATAAAATTCAAAAAAAACACAAAGTTAGTAAATAAAATTAGAAAAAAA

Reverse complement sequence

TTTTTTTCTAATTTTATTTACTAACTTTGTGTTTTTTTTGAATTTTATGATGAAAGGAAAGAAGGGAAAGGAGTATAGGGGGAGGGGCGGGTTGATCGCT[T/C]
CCAGCGATCACCCACCCATTAGCCTCATCCGCTCTTGATCACTATAATATAGAAATATGGTTGCATGAGGGTAAAAAAATGGAAAGAATATTAAGAAAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.60%	7.70%	0.66%	0.04%	NA
All Indica	2759	97.40%	2.30%	0.29%	0.04%	NA
All Japonica	1512	79.00%	19.50%	1.46%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.30%	3.70%	1.01%	0.00%	NA
Indica II	465	94.00%	5.60%	0.22%	0.22%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.70%	0.13%	0.00%	NA
Temperate Japonica	767	61.90%	35.70%	2.22%	0.13%	NA
Tropical Japonica	504	99.20%	0.40%	0.40%	0.00%	NA
Japonica Intermediate	241	90.90%	7.90%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418762497	A -> DEL	N	N	silent_mutation	Average:50.509; most accessible tissue: Zhenshan97 flower, score: 82.834	N	N	N	N
vg0418762497	A -> G	LOC_Os04g31350.1	upstream_gene_variant ; 3649.0bp to feature; MODIFIER	silent_mutation	Average:50.509; most accessible tissue: Zhenshan97 flower, score: 82.834	N	N	N	N
vg0418762497	A -> G	LOC_Os04g31360.1	upstream_gene_variant ; 798.0bp to feature; MODIFIER	silent_mutation	Average:50.509; most accessible tissue: Zhenshan97 flower, score: 82.834	N	N	N	N
vg0418762497	A -> G	LOC_Os04g31370.1	upstream_gene_variant ; 2924.0bp to feature; MODIFIER	silent_mutation	Average:50.509; most accessible tissue: Zhenshan97 flower, score: 82.834	N	N	N	N
vg0418762497	A -> G	LOC_Os04g31360-LOC_Os04g31370	intergenic_region ; MODIFIER	silent_mutation	Average:50.509; most accessible tissue: Zhenshan97 flower, score: 82.834	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418762497	3.82E-07	NA	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0418762497	NA	9.14E-06	mr1138	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	NA	5.14E-08	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	4.80E-07	4.80E-07	mr1343	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	NA	1.29E-06	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	NA	7.01E-08	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	NA	8.49E-06	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	NA	3.14E-06	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	NA	5.03E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	NA	2.89E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	NA	1.10E-08	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	NA	3.29E-10	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	NA	1.25E-06	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	NA	7.64E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	4.78E-06	NA	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	NA	9.61E-08	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	NA	1.58E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	5.12E-08	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418762497	NA	6.30E-08	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251