Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0418016156:

Variant ID: vg0418016156 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 18016156
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAACAGGATGACAGAGCGAATCCGGGCGTTGGCTCATCGATCCAACGGCTATAACATGCTCCGACTGCTAAAGTTGCAGTCGTTACTGCTACAACACCA[T/G]
ATCTCAATTCGAATATGTCATATTATACTCTAATCTATAGTACTTGGATTATGACCTATGGGACAATTTTTTATGGGAAAAAAGTCCGTGTTACACCTAG

Reverse complement sequence

CTAGGTGTAACACGGACTTTTTTCCCATAAAAAATTGTCCCATAGGTCATAATCCAAGTACTATAGATTAGAGTATAATATGACATATTCGAATTGAGAT[A/C]
TGGTGTTGTAGCAGTAACGACTGCAACTTTAGCAGTCGGAGCATGTTATAGCCGTTGGATCGATGAGCCAACGCCCGGATTCGCTCTGTCATCCTGTTGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.80%	5.60%	4.42%	55.10%	NA
All Indica	2759	37.20%	0.90%	3.19%	58.72%	NA
All Japonica	1512	21.10%	12.90%	5.75%	60.25%	NA
Aus	269	90.70%	1.10%	5.95%	2.23%	NA
Indica I	595	79.20%	1.20%	8.24%	11.43%	NA
Indica II	465	8.80%	2.20%	1.51%	87.53%	NA
Indica III	913	25.50%	0.30%	1.20%	72.95%	NA
Indica Intermediate	786	35.90%	0.50%	2.67%	60.94%	NA
Temperate Japonica	767	20.60%	18.10%	9.52%	51.76%	NA
Tropical Japonica	504	20.80%	7.50%	1.59%	70.04%	NA
Japonica Intermediate	241	23.20%	7.50%	2.49%	66.80%	NA
VI/Aromatic	96	26.00%	44.80%	4.17%	25.00%	NA
Intermediate	90	34.40%	2.20%	15.56%	47.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0418016156	T -> DEL	N	N	silent_mutation	Average:20.882; most accessible tissue: Callus, score: 46.015	N	N	N	N
vg0418016156	T -> G	LOC_Os04g30170.1	upstream_gene_variant ; 4285.0bp to feature; MODIFIER	silent_mutation	Average:20.882; most accessible tissue: Callus, score: 46.015	N	N	N	N
vg0418016156	T -> G	LOC_Os04g30180.1	downstream_gene_variant ; 1054.0bp to feature; MODIFIER	silent_mutation	Average:20.882; most accessible tissue: Callus, score: 46.015	N	N	N	N
vg0418016156	T -> G	LOC_Os04g30190.1	downstream_gene_variant ; 1024.0bp to feature; MODIFIER	silent_mutation	Average:20.882; most accessible tissue: Callus, score: 46.015	N	N	N	N
vg0418016156	T -> G	LOC_Os04g30180-LOC_Os04g30190	intergenic_region ; MODIFIER	silent_mutation	Average:20.882; most accessible tissue: Callus, score: 46.015	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0418016156	1.01E-13	1.45E-27	Awn_length	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0418016156	NA	3.83E-11	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0418016156	NA	1.08E-06	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418016156	NA	1.04E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418016156	NA	8.62E-08	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418016156	NA	8.78E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0418016156	NA	5.66E-08	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251