Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0333549681:

Variant ID: vg0333549681 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 33549681
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAAAAGCTAAACATGATTGCCCACTTACACAGCAATACAACACTATCAATATTGCACTTATCTCTGATGAATGTGGAACATCCACTTACAGTGCGGTAC[G/A]
GAAATGATGTGACGTGTCGTCCATCAACGTTCACGTGGTAACCCTCCAACCCGGCGGTAAGAGTAAGAACGAACATGCAGTCCTCCACAAACGGGTATGG

Reverse complement sequence

CCATACCCGTTTGTGGAGGACTGCATGTTCGTTCTTACTCTTACCGCCGGGTTGGAGGGTTACCACGTGAACGTTGATGGACGACACGTCACATCATTTC[C/T]
GTACCGCACTGTAAGTGGATGTTCCACATTCATCAGAGATAAGTGCAATATTGATAGTGTTGTATTGCTGTGTAAGTGGGCAATCATGTTTAGCTTTTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.00% 4.50% 0.40% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 84.70% 14.00% 1.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 76.00% 21.50% 2.48% 0.00% NA
Tropical Japonica  504 95.60% 4.40% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0333549681 G -> A LOC_Os03g58920.2 missense_variant ; p.Pro351Leu; MODERATE nonsynonymous_codon ; P351L Average:77.322; most accessible tissue: Minghui63 flower, score: 86.696 probably damaging 2.252 DELETERIOUS 0.00
vg0333549681 G -> A LOC_Os03g58920.1 missense_variant ; p.Pro351Leu; MODERATE nonsynonymous_codon ; P351L Average:77.322; most accessible tissue: Minghui63 flower, score: 86.696 probably damaging 2.252 DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0333549681 G A -0.01 0.0 0.01 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0333549681 2.08E-12 1.01E-19 Awn_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0333549681 5.44E-06 4.28E-10 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0333549681 NA 4.72E-15 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0333549681 NA 9.69E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0333549681 NA 1.96E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0333549681 NA 7.75E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251