Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203485364:

Variant ID: vg0203485364 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 3485364
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATACGTACTCTTGCCCAACTGTACGGTATTTTCAGTATCTAGCTACACGTATCGTACGTATTTGTGATAGGGATAGGGATTTTTTTATTTTCTTTATTTT[T/C]
TTTATTTTATTTTTGGTGAGAGGATGGGGGTGGCTTTTGACAGCTACGGCTGAAAATTCTGGACTAGTTTTTGACAGCTACGTTTTCTTAAATTCCACCC

Reverse complement sequence

GGGTGGAATTTAAGAAAACGTAGCTGTCAAAAACTAGTCCAGAATTTTCAGCCGTAGCTGTCAAAAGCCACCCCCATCCTCTCACCAAAAATAAAATAAA[A/G]
AAAATAAAGAAAATAAAAAAATCCCTATCCCTATCACAAATACGTACGATACGTGTAGCTAGATACTGAAAATACCGTACAGTTGGGCAAGAGTACGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.30% 18.00% 3.64% 0.04% NA
All Indica  2759 96.00% 3.00% 1.05% 0.00% NA
All Japonica  1512 58.90% 31.90% 9.06% 0.07% NA
Aus  269 15.20% 84.00% 0.37% 0.37% NA
Indica I  595 98.20% 0.70% 1.18% 0.00% NA
Indica II  465 98.30% 1.10% 0.65% 0.00% NA
Indica III  913 95.60% 4.10% 0.33% 0.00% NA
Indica Intermediate  786 93.40% 4.60% 2.04% 0.00% NA
Temperate Japonica  767 40.50% 45.60% 13.82% 0.00% NA
Tropical Japonica  504 88.70% 8.50% 2.58% 0.20% NA
Japonica Intermediate  241 55.20% 37.30% 7.47% 0.00% NA
VI/Aromatic  96 58.30% 40.60% 1.04% 0.00% NA
Intermediate  90 72.20% 23.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0203485364 T -> DEL N N silent_mutation Average:86.511; most accessible tissue: Minghui63 flower, score: 95.632 N N N N
vg0203485364 T -> C LOC_Os02g06910.1 upstream_gene_variant ; 1449.0bp to feature; MODIFIER silent_mutation Average:86.511; most accessible tissue: Minghui63 flower, score: 95.632 N N N N
vg0203485364 T -> C LOC_Os02g06890-LOC_Os02g06910 intergenic_region ; MODIFIER silent_mutation Average:86.511; most accessible tissue: Minghui63 flower, score: 95.632 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0203485364 T C -0.02 -0.02 -0.04 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0203485364 NA 2.31E-17 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0203485364 NA 4.94E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203485364 2.40E-06 NA mr1147 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203485364 NA 8.59E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251