Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126772523:

Variant ID: vg0126772523 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 26772523
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GAAATTTCAGGGGTATAGAAGGGATCGGGCAAATTTCAAGGGTATGAAAGGGATTGAGTGAGTTTTCAAAGGTATACAGGGAATTTACTCTTTAAATTTA[A/G]
GCACTCATATCAGCCTTCTTACTCTAAAGTAGAGTAAAGCAAGCGAGTGGCATCCCTCTCTATTTTGTTTTAGCTCACTTCCAAGGATATACAGGGAATT

Reverse complement sequence

AATTCCCTGTATATCCTTGGAAGTGAGCTAAAACAAAATAGAGAGGGATGCCACTCGCTTGCTTTACTCTACTTTAGAGTAAGAAGGCTGATATGAGTGC[T/C]
TAAATTTAAAGAGTAAATTCCCTGTATACCTTTGAAAACTCACTCAATCCCTTTCATACCCTTGAAATTTGCCCGATCCCTTCTATACCCCTGAAATTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.60%	37.90%	12.53%	0.00%	NA
All Indica	2759	74.80%	11.90%	13.37%	0.00%	NA
All Japonica	1512	3.10%	87.80%	9.13%	0.00%	NA
Aus	269	71.70%	11.50%	16.73%	0.00%	NA
Indica I	595	66.20%	10.60%	23.19%	0.00%	NA
Indica II	465	74.60%	13.30%	12.04%	0.00%	NA
Indica III	913	79.20%	12.80%	8.00%	0.00%	NA
Indica Intermediate	786	76.20%	10.80%	12.98%	0.00%	NA
Temperate Japonica	767	1.40%	92.60%	6.00%	0.00%	NA
Tropical Japonica	504	5.80%	80.00%	14.29%	0.00%	NA
Japonica Intermediate	241	2.90%	88.80%	8.30%	0.00%	NA
VI/Aromatic	96	17.70%	54.20%	28.12%	0.00%	NA
Intermediate	90	24.40%	61.10%	14.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0126772523	A -> G	LOC_Os01g46910.1	upstream_gene_variant ; 3333.0bp to feature; MODIFIER	silent_mutation	Average:47.575; most accessible tissue: Zhenshan97 flag leaf, score: 73.822	N	N	N	N
vg0126772523	A -> G	LOC_Os01g46920.1	downstream_gene_variant ; 607.0bp to feature; MODIFIER	silent_mutation	Average:47.575; most accessible tissue: Zhenshan97 flag leaf, score: 73.822	N	N	N	N
vg0126772523	A -> G	LOC_Os01g46910-LOC_Os01g46920	intergenic_region ; MODIFIER	silent_mutation	Average:47.575; most accessible tissue: Zhenshan97 flag leaf, score: 73.822	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0126772523	4.20E-06	NA	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0126772523	NA	3.63E-26	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126772523	NA	2.77E-16	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126772523	NA	4.79E-27	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126772523	NA	7.61E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126772523	NA	7.80E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126772523	1.05E-07	NA	mr1057_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126772523	NA	1.35E-07	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126772523	NA	1.44E-10	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251