Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1227340278:

Variant ID: vg1227340278 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 27340278
Reference Allele: GAlternative Allele: GA,GAA,GAAA
Primary Allele: GASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAACTTATCACTTTGGCTTGCATCAGTACCTAGCTAGTTGACAGCATTTTTTCTGTGGTTTGGTTTAAGTGGATTTGCAGCAGCCAGACAGATAAATGA[G/GA,GAA,GAAA]
AAAAAAAAAGATGAACAGAAGGTCTCCACTATGTACAGACCACCACAGTGATTTGGTTCTGCCCAAAGAACCAGCTGGGCACAAAAGAAGAAGATGTGAA

Reverse complement sequence

TTCACATCTTCTTCTTTTGTGCCCAGCTGGTTCTTTGGGCAGAACCAAATCACTGTGGTGGTCTGTACATAGTGGAGACCTTCTGTTCATCTTTTTTTTT[C/TC,TTC,TTTC]
TCATTTATCTGTCTGGCTGCTGCAAATCCACTTAAACCAAACCACAGAAAAAATGCTGTCAACTAGCTAGGTACTGATGCAAGCCAAAGTGATAAGTTAA

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 32.10% 0.63% 0.00% GAAA: 6.12%; GAA: 0.49%
All Indica  2759 96.70% 1.80% 0.04% 0.00% GAAA: 1.27%; GAA: 0.18%
All Japonica  1512 7.40% 91.50% 0.99% 0.00% GAAA: 0.07%
Aus  269 5.90% 1.10% 2.60% 0.00% GAAA: 84.01%; GAA: 6.32%
Indica I  595 98.50% 1.30% 0.00% 0.00% GAAA: 0.17%
Indica II  465 97.40% 1.30% 0.00% 0.00% GAAA: 1.29%
Indica III  913 97.20% 2.00% 0.11% 0.00% GAAA: 0.44%; GAA: 0.33%
Indica Intermediate  786 94.50% 2.20% 0.00% 0.00% GAAA: 3.05%; GAA: 0.25%
Temperate Japonica  767 12.40% 86.30% 1.30% 0.00% NA
Tropical Japonica  504 0.80% 99.00% 0.20% 0.00% NA
Japonica Intermediate  241 5.40% 92.50% 1.66% 0.00% GAAA: 0.41%
VI/Aromatic  96 25.00% 50.00% 6.25% 0.00% GAAA: 17.71%; GAA: 1.04%
Intermediate  90 52.20% 35.60% 1.11% 0.00% GAAA: 11.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1227340278 G -> GAA LOC_Os12g44090.1 3_prime_UTR_variant ; 210.0bp to feature; MODIFIER silent_mutation Average:68.535; most accessible tissue: Callus, score: 95.672 N N N N
vg1227340278 G -> GAA LOC_Os12g44080.1 upstream_gene_variant ; 2499.0bp to feature; MODIFIER silent_mutation Average:68.535; most accessible tissue: Callus, score: 95.672 N N N N
vg1227340278 G -> GAAA LOC_Os12g44090.1 3_prime_UTR_variant ; 210.0bp to feature; MODIFIER silent_mutation Average:68.535; most accessible tissue: Callus, score: 95.672 N N N N
vg1227340278 G -> GAAA LOC_Os12g44080.1 upstream_gene_variant ; 2499.0bp to feature; MODIFIER silent_mutation Average:68.535; most accessible tissue: Callus, score: 95.672 N N N N
vg1227340278 G -> GA LOC_Os12g44090.1 3_prime_UTR_variant ; 210.0bp to feature; MODIFIER silent_mutation Average:68.535; most accessible tissue: Callus, score: 95.672 N N N N
vg1227340278 G -> GA LOC_Os12g44080.1 upstream_gene_variant ; 2499.0bp to feature; MODIFIER silent_mutation Average:68.535; most accessible tissue: Callus, score: 95.672 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1227340278 G GA 0.07 0.03 0.03 -0.05 0.04 0.06
vg1227340278 G GAA 0.0 -0.05 -0.03 0.01 -0.03 -0.01
vg1227340278 G GAAA -0.16 -0.18 -0.12 -0.03 -0.14 -0.19