| Variant ID: vg1223326650 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 23326650 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 336. )
AGTTGACCCACCGGAGGCGGCAGCTCTTGCCTGTGCGATTAAGGCCTGCATGGAGATACAAACAGTGTGTGCAAGAAGAGAACTCGGTTAGAGATGGTGG[C/T]
GTTTCCTGTTGCGACTTAGCGCGAAGGAATTCAATATAGCTACCTAATTTTTGGATCCCCCACCCCTCAAACCTGATACTTTGGCAATGAAATCCCAACG
CGTTGGGATTTCATTGCCAAAGTATCAGGTTTGAGGGGTGGGGGATCCAAAAATTAGGTAGCTATATTGAATTCCTTCGCGCTAAGTCGCAACAGGAAAC[G/A]
CCACCATCTCTAACCGAGTTCTCTTCTTGCACACACTGTTTGTATCTCCATGCAGGCCTTAATCGCACAGGCAAGAGCTGCCGCCTCCGGTGGGTCAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 61.90% | 38.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1223326650 | C -> T | LOC_Os12g37970.3 | 5_prime_UTR_variant ; 130.0bp to feature; MODIFIER | silent_mutation | Average:78.539; most accessible tissue: Zhenshan97 flower, score: 85.807 | N | N | N | N |
| vg1223326650 | C -> T | LOC_Os12g37960.1 | downstream_gene_variant ; 2897.0bp to feature; MODIFIER | silent_mutation | Average:78.539; most accessible tissue: Zhenshan97 flower, score: 85.807 | N | N | N | N |
| vg1223326650 | C -> T | LOC_Os12g37960.2 | downstream_gene_variant ; 2897.0bp to feature; MODIFIER | silent_mutation | Average:78.539; most accessible tissue: Zhenshan97 flower, score: 85.807 | N | N | N | N |
| vg1223326650 | C -> T | LOC_Os12g37970.1 | intron_variant ; MODIFIER | silent_mutation | Average:78.539; most accessible tissue: Zhenshan97 flower, score: 85.807 | N | N | N | N |
| vg1223326650 | C -> T | LOC_Os12g37970.2 | intron_variant ; MODIFIER | silent_mutation | Average:78.539; most accessible tissue: Zhenshan97 flower, score: 85.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1223326650 | NA | 1.91E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223326650 | NA | 3.47E-06 | mr1081 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223326650 | NA | 1.49E-06 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223326650 | NA | 3.74E-08 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223326650 | NA | 6.36E-07 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223326650 | NA | 7.77E-06 | mr1254 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223326650 | NA | 2.39E-06 | mr1268 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223326650 | NA | 2.52E-08 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223326650 | NA | 1.15E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223326650 | NA | 2.29E-09 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223326650 | NA | 2.66E-06 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1223326650 | NA | 2.21E-08 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |