Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223326452:

Variant ID: vg1223326452 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23326452
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, T: 0.25, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

AGACGCCTTGCTATCCTGGACCACCTATTGAGGAGAACACCAAATATATCATCCATAGTAGTAGAGAAATTAAGCTCTTTGTTCTTGACATTATCCTTTG[G/T]
ATCATATCATACCTGTTTCCCCACCGAGCATGGAGCTCAAGGATGAGGCGCTCTTCATGCGGAGACATGCGCCCACGCTTGAGGCCAGGGTGGAGGTAGT

Reverse complement sequence

ACTACCTCCACCCTGGCCTCAAGCGTGGGCGCATGTCTCCGCATGAAGAGCGCCTCATCCTTGAGCTCCATGCTCGGTGGGGAAACAGGTATGATATGAT[C/A]
CAAAGGATAATGTCAAGAACAAAGAGCTTAATTTCTCTACTACTATGGATGATATATTTGGTGTTCTCCTCAATAGGTGGTCCAGGATAGCAAGGCGTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.10%	32.40%	0.02%	0.57%	NA
All Indica	2759	51.70%	47.40%	0.00%	0.91%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.07%	NA
Aus	269	30.50%	69.50%	0.00%	0.00%	NA
Indica I	595	25.40%	73.10%	0.00%	1.51%	NA
Indica II	465	81.70%	17.60%	0.00%	0.65%	NA
Indica III	913	44.10%	55.20%	0.00%	0.66%	NA
Indica Intermediate	786	62.60%	36.50%	0.00%	0.89%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	74.40%	23.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223326452	G -> DEL	N	N	silent_mutation	Average:77.098; most accessible tissue: Zhenshan97 flower, score: 82.718	N	N	N	N
vg1223326452	G -> T	LOC_Os12g37960.1	downstream_gene_variant ; 2699.0bp to feature; MODIFIER	silent_mutation	Average:77.098; most accessible tissue: Zhenshan97 flower, score: 82.718	N	N	N	N
vg1223326452	G -> T	LOC_Os12g37960.2	downstream_gene_variant ; 2699.0bp to feature; MODIFIER	silent_mutation	Average:77.098; most accessible tissue: Zhenshan97 flower, score: 82.718	N	N	N	N
vg1223326452	G -> T	LOC_Os12g37970.1	intron_variant ; MODIFIER	silent_mutation	Average:77.098; most accessible tissue: Zhenshan97 flower, score: 82.718	N	N	N	N
vg1223326452	G -> T	LOC_Os12g37970.2	intron_variant ; MODIFIER	silent_mutation	Average:77.098; most accessible tissue: Zhenshan97 flower, score: 82.718	N	N	N	N
vg1223326452	G -> T	LOC_Os12g37970.3	intron_variant ; MODIFIER	silent_mutation	Average:77.098; most accessible tissue: Zhenshan97 flower, score: 82.718	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1223326452	NA	2.02E-12	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223326452	NA	1.25E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223326452	NA	4.88E-06	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223326452	NA	1.80E-07	mr1148	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223326452	NA	2.97E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223326452	NA	1.80E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223326452	NA	8.75E-14	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223326452	NA	9.01E-06	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223326452	NA	8.58E-07	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223326452	NA	4.10E-07	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223326452	NA	2.47E-07	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223326452	NA	1.10E-08	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223326452	NA	3.93E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223326452	NA	1.14E-07	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251