Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223000666:

Variant ID: vg1223000666 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23000666
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGCCGCCTTCTTCGCCGCCGCCGCCTTGGCGCGCACCGCGCCCATCGCCAGCCGCAGCACCGCCGTGGCGTCCAGCTTCGCCGCCGCCCCCGCCGCCGG[C/G]
GGCGGCACCACCGTCATCTGGCACACCACCGGGTAGTCCGTCTTCGCGCACAGCGCCTTCACGAGGTCGCCGCCGGGGCCGGGAAGGATCGGCTTCGCCT

Reverse complement sequence

AGGCGAAGCCGATCCTTCCCGGCCCCGGCGGCGACCTCGTGAAGGCGCTGTGCGCGAAGACGGACTACCCGGTGGTGTGCCAGATGACGGTGGTGCCGCC[G/C]
CCGGCGGCGGGGGCGGCGGCGAAGCTGGACGCCACGGCGGTGCTGCGGCTGGCGATGGGCGCGGTGCGCGCCAAGGCGGCGGCGGCGAAGAAGGCGGCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 0.70% 12.12% 1.61% NA
All Indica  2759 92.20% 1.00% 6.16% 0.65% NA
All Japonica  1512 72.60% 0.10% 23.68% 3.57% NA
Aus  269 92.90% 0.00% 6.32% 0.74% NA
Indica I  595 76.60% 0.00% 21.18% 2.18% NA
Indica II  465 95.70% 1.30% 2.58% 0.43% NA
Indica III  913 98.60% 0.80% 0.55% 0.11% NA
Indica Intermediate  786 94.40% 1.90% 3.44% 0.25% NA
Temperate Japonica  767 54.90% 0.30% 38.46% 6.39% NA
Tropical Japonica  504 94.20% 0.00% 5.56% 0.20% NA
Japonica Intermediate  241 83.80% 0.00% 14.52% 1.66% NA
VI/Aromatic  96 81.20% 0.00% 16.67% 2.08% NA
Intermediate  90 85.60% 1.10% 13.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223000666 C -> DEL LOC_Os12g37480.1 N frameshift_variant Average:80.241; most accessible tissue: Minghui63 panicle, score: 93.837 N N N N
vg1223000666 C -> G LOC_Os12g37480.1 synonymous_variant ; p.Pro96Pro; LOW synonymous_codon Average:80.241; most accessible tissue: Minghui63 panicle, score: 93.837 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1223000666 C G 0.01 0.01 0.02 0.01 0.03 0.04