Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223000349:

Variant ID: vg1223000349 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23000349
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCGTGCGTCTAGCTGCTGGAGCGGAGGCCGGCGGCGACGGCGATGGCGATGCAGTTGCTGGCGAGCTTGGCGAGCTCGGCGTCCTGCTTGGACATGAGC[G/A]
GCGGGATGTCGCCGTCGCGTTCCTCGAAGCCCTGGTCGCAGGTGTCGACGTCGGTGCGGGCCGTGTCGAGCATGGTGCCCGTCGTGTCCTTGTCGCCGGC

Reverse complement sequence

GCCGGCGACAAGGACACGACGGGCACCATGCTCGACACGGCCCGCACCGACGTCGACACCTGCGACCAGGGCTTCGAGGAACGCGACGGCGACATCCCGC[C/T]
GCTCATGTCCAAGCAGGACGCCGAGCTCGCCAAGCTCGCCAGCAACTGCATCGCCATCGCCGTCGCCGCCGGCCTCCGCTCCAGCAGCTAGACGCACGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.60%	3.50%	8.21%	19.68%	NA
All Indica	2759	84.10%	0.60%	6.52%	8.77%	NA
All Japonica	1512	48.70%	0.00%	12.17%	39.09%	NA
Aus	269	32.00%	52.00%	2.60%	13.38%	NA
Indica I	595	62.50%	0.00%	12.94%	24.54%	NA
Indica II	465	91.40%	0.20%	3.87%	4.52%	NA
Indica III	913	94.40%	0.30%	2.19%	3.07%	NA
Indica Intermediate	786	84.20%	1.50%	8.27%	5.98%	NA
Temperate Japonica	767	41.10%	0.00%	14.86%	44.07%	NA
Tropical Japonica	504	58.70%	0.00%	9.52%	31.75%	NA
Japonica Intermediate	241	52.30%	0.00%	9.13%	38.59%	NA
VI/Aromatic	96	43.80%	6.20%	7.29%	42.71%	NA
Intermediate	90	64.40%	2.20%	11.11%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223000349	G -> DEL	LOC_Os12g37480.1	N	frameshift_variant	Average:80.134; most accessible tissue: Minghui63 panicle, score: 92.078	N	N	N	N
vg1223000349	G -> A	LOC_Os12g37480.1	missense_variant ; p.Pro202Leu; MODERATE	nonsynonymous_codon ; P202L	Average:80.134; most accessible tissue: Minghui63 panicle, score: 92.078	unknown	unknown	TOLERATED	0.08

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1223000349	G	A	0.05	0.02	0.02	0.01	0.03	0.02