Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223000154:

Variant ID: vg1223000154 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23000154
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TATATATATGTATGTGTGTGTTTAGATTTATTAACATCTATATAAATGTGAGCAATACTAAAAATTCTTATAACCTGAAACGTAGGAAATAATAATTAAG[G/T]
TGCCAAAGTCTAGGTTTTCTTTCTATCGCTATATATATATATGTACGTAGTAGTATACTATATATAGGATCATATCGATCGGTCGCCGGCCGGCGGCGTG

Reverse complement sequence

CACGCCGCCGGCCGGCGACCGATCGATATGATCCTATATATAGTATACTACTACGTACATATATATATATAGCGATAGAAAGAAAACCTAGACTTTGGCA[C/A]
CTTAATTATTATTTCCTACGTTTCAGGTTATAAGAATTTTTAGTATTGCTCACATTTATATAGATGTTAATAAATCTAAACACACACATACATATATATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	6.30%	0.00%	0.00%	NA
All Indica	2759	89.70%	10.30%	0.00%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	61.10%	38.90%	0.00%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	88.30%	11.70%	0.00%	0.00%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223000154	G -> T	LOC_Os12g37480.1	3_prime_UTR_variant ; 104.0bp to feature; MODIFIER	silent_mutation	Average:64.696; most accessible tissue: Zhenshan97 flower, score: 85.314	N	N	N	N
vg1223000154	G -> T	LOC_Os12g37470.1	upstream_gene_variant ; 1630.0bp to feature; MODIFIER	silent_mutation	Average:64.696; most accessible tissue: Zhenshan97 flower, score: 85.314	N	N	N	N
vg1223000154	G -> T	LOC_Os12g37490.1	downstream_gene_variant ; 2057.0bp to feature; MODIFIER	silent_mutation	Average:64.696; most accessible tissue: Zhenshan97 flower, score: 85.314	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1223000154	G	T	-0.05	-0.03	-0.03	-0.04	-0.05	-0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1223000154	NA	2.50E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000154	NA	8.97E-06	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000154	NA	5.29E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000154	NA	1.66E-10	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000154	NA	4.83E-10	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000154	NA	1.03E-12	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000154	NA	6.23E-12	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000154	NA	1.31E-09	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000154	NA	7.97E-08	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000154	NA	3.32E-06	mr1986	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000154	NA	2.25E-07	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000154	NA	1.87E-09	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000154	NA	1.72E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000154	NA	6.35E-09	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000154	NA	1.55E-08	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251