Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223000128:

Variant ID: vg1223000128 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 23000128
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTATATATATATATATATAATATATATATATATATGTATGTGTGTGTTTAGATTTATTAACATCTATATAAATGTGAGCAATACTAAAAATTCTTATAAC[C/A]
TGAAACGTAGGAAATAATAATTAAGGTGCCAAAGTCTAGGTTTTCTTTCTATCGCTATATATATATATGTACGTAGTAGTATACTATATATAGGATCATA

Reverse complement sequence

TATGATCCTATATATAGTATACTACTACGTACATATATATATATAGCGATAGAAAGAAAACCTAGACTTTGGCACCTTAATTATTATTTCCTACGTTTCA[G/T]
GTTATAAGAATTTTTAGTATTGCTCACATTTATATAGATGTTAATAAATCTAAACACACACATACATATATATATATATATTATATATATATATATATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 6.30% 0.00% 0.00% NA
All Indica  2759 89.70% 10.30% 0.00% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 61.10% 38.90% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 88.30% 11.70% 0.00% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1223000128 C -> A LOC_Os12g37480.1 3_prime_UTR_variant ; 130.0bp to feature; MODIFIER silent_mutation Average:61.99; most accessible tissue: Zhenshan97 flower, score: 84.119 N N N N
vg1223000128 C -> A LOC_Os12g37470.1 upstream_gene_variant ; 1604.0bp to feature; MODIFIER silent_mutation Average:61.99; most accessible tissue: Zhenshan97 flower, score: 84.119 N N N N
vg1223000128 C -> A LOC_Os12g37490.1 downstream_gene_variant ; 2083.0bp to feature; MODIFIER silent_mutation Average:61.99; most accessible tissue: Zhenshan97 flower, score: 84.119 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1223000128 C A 0.05 0.02 0.01 0.0 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1223000128 NA 2.08E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 7.72E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 4.33E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 5.00E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 6.64E-06 mr1081 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 6.57E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 1.25E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 5.14E-11 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 1.61E-10 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 5.84E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 1.97E-13 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 8.70E-13 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 9.22E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 4.14E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 9.82E-10 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 6.52E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 9.58E-07 mr1986 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 1.49E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 6.62E-08 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 9.41E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 4.71E-10 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 7.59E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 9.77E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 7.40E-06 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 2.03E-08 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 3.86E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 2.64E-09 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223000128 NA 6.44E-09 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251