Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222419888:

Variant ID: vg1222419888 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22419888
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, G: 0.36, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

ACTTTCCTACACACACAAATTTCCAACTTTTCCGTCACATCATTCCAATTTTAACCAAATTTCTAATTTTGGCGTTGATTTGATATGATTTGACAATGTG[A/G]
TGCTACCGTAAATATTTGCTAATGACAGATTAATTAGGCTTAATAGATTCGTCTCGCAGTTTATATGCGGAATTTATAATTTGTTTTGTTATTAGTCTAC

Reverse complement sequence

GTAGACTAATAACAAAACAAATTATAAATTCCGCATATAAACTGCGAGACGAATCTATTAAGCCTAATTAATCTGTCATTAGCAAATATTTACGGTAGCA[T/C]
CACATTGTCAAATCATATCAAATCAACGCCAAAATTAGAAATTTGGTTAAAATTGGAATGATGTGACGGAAAAGTTGGAAATTTGTGTGTGTAGGAAAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.40%	24.40%	0.83%	43.42%	NA
All Indica	2759	35.70%	2.80%	1.23%	60.28%	NA
All Japonica	1512	19.10%	67.70%	0.20%	12.96%	NA
Aus	269	34.90%	1.10%	0.37%	63.57%	NA
Indica I	595	37.80%	2.00%	1.01%	59.16%	NA
Indica II	465	17.20%	3.70%	0.65%	78.49%	NA
Indica III	913	43.40%	1.90%	0.99%	53.78%	NA
Indica Intermediate	786	36.10%	3.90%	2.04%	57.89%	NA
Temperate Japonica	767	14.10%	77.30%	0.00%	8.60%	NA
Tropical Japonica	504	13.10%	65.50%	0.60%	20.83%	NA
Japonica Intermediate	241	47.70%	41.90%	0.00%	10.37%	NA
VI/Aromatic	96	87.50%	7.30%	0.00%	5.21%	NA
Intermediate	90	33.30%	46.70%	1.11%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222419888	A -> DEL	N	N	silent_mutation	Average:6.436; most accessible tissue: Callus, score: 19.452	N	N	N	N
vg1222419888	A -> G	LOC_Os12g36600.1	downstream_gene_variant ; 4272.0bp to feature; MODIFIER	silent_mutation	Average:6.436; most accessible tissue: Callus, score: 19.452	N	N	N	N
vg1222419888	A -> G	LOC_Os12g36610.1	downstream_gene_variant ; 623.0bp to feature; MODIFIER	silent_mutation	Average:6.436; most accessible tissue: Callus, score: 19.452	N	N	N	N
vg1222419888	A -> G	LOC_Os12g36620.1	intron_variant ; MODIFIER	silent_mutation	Average:6.436; most accessible tissue: Callus, score: 19.452	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222419888	NA	1.04E-08	mr1050_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419888	NA	2.95E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419888	NA	2.14E-07	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419888	NA	9.96E-06	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419888	9.53E-06	7.55E-23	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419888	NA	1.94E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419888	NA	5.05E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251