Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222419829:

Variant ID: vg1222419829 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22419829
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.44, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

TAGGCCAAGTTTAGTTCCAAAATTTTTCTTCAAACTTTCAACTTTTTCATCACATCAAAACTTTCCTACACACACAAATTTCCAACTTTTCCGTCACATC[A/G]
TTCCAATTTTAACCAAATTTCTAATTTTGGCGTTGATTTGATATGATTTGACAATGTGATGCTACCGTAAATATTTGCTAATGACAGATTAATTAGGCTT

Reverse complement sequence

AAGCCTAATTAATCTGTCATTAGCAAATATTTACGGTAGCATCACATTGTCAAATCATATCAAATCAACGCCAAAATTAGAAATTTGGTTAAAATTGGAA[T/C]
GATGTGACGGAAAAGTTGGAAATTTGTGTGTGTAGGAAAGTTTTGATGTGATGAAAAAGTTGAAAGTTTGAAGAAAAATTTTGGAACTAAACTTGGCCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.20%	24.30%	0.57%	43.93%	NA
All Indica	2759	35.40%	2.80%	0.91%	60.96%	NA
All Japonica	1512	19.20%	67.50%	0.07%	13.23%	NA
Aus	269	34.90%	1.10%	0.37%	63.57%	NA
Indica I	595	37.50%	2.00%	0.84%	59.66%	NA
Indica II	465	17.40%	3.40%	0.22%	78.92%	NA
Indica III	913	42.90%	2.10%	0.88%	54.11%	NA
Indica Intermediate	786	35.60%	3.70%	1.40%	59.29%	NA
Temperate Japonica	767	14.20%	77.20%	0.13%	8.47%	NA
Tropical Japonica	504	13.30%	64.90%	0.00%	21.83%	NA
Japonica Intermediate	241	47.70%	41.90%	0.00%	10.37%	NA
VI/Aromatic	96	87.50%	7.30%	0.00%	5.21%	NA
Intermediate	90	34.40%	45.60%	0.00%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222419829	A -> DEL	N	N	silent_mutation	Average:6.272; most accessible tissue: Callus, score: 19.452	N	N	N	N
vg1222419829	A -> G	LOC_Os12g36600.1	downstream_gene_variant ; 4213.0bp to feature; MODIFIER	silent_mutation	Average:6.272; most accessible tissue: Callus, score: 19.452	N	N	N	N
vg1222419829	A -> G	LOC_Os12g36610.1	downstream_gene_variant ; 564.0bp to feature; MODIFIER	silent_mutation	Average:6.272; most accessible tissue: Callus, score: 19.452	N	N	N	N
vg1222419829	A -> G	LOC_Os12g36620.1	intron_variant ; MODIFIER	silent_mutation	Average:6.272; most accessible tissue: Callus, score: 19.452	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222419829	NA	5.60E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419829	NA	2.33E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419829	NA	4.43E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419829	NA	1.77E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419829	NA	1.49E-07	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419829	NA	4.46E-22	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419829	NA	5.46E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222419829	NA	1.28E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251