Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222231033:

Variant ID: vg1222231033 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22231033
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCGATGTCTTCATGAAAGAAAAGCTGAGCAGTATTTGGGATGGCTACAGAGGCTTGTTACAGACAACAGTAAGGACATCAGTTTCACTAATGAACGTTT[T/C]
AAGCTACCTGGAGTGCAACACAGCTAGGGGTTCCTGCATATTCAACATCACATACATCCTAGCTACTGCACTATCTAAAGCTGGGAGTTCAGGTGGTGGT

Reverse complement sequence

ACCACCACCTGAACTCCCAGCTTTAGATAGTGCAGTAGCTAGGATGTATGTGATGTTGAATATGCAGGAACCCCTAGCTGTGTTGCACTCCAGGTAGCTT[A/G]
AAACGTTCATTAGTGAAACTGATGTCCTTACTGTTGTCTGTAACAAGCCTCTGTAGCCATCCCAAATACTGCTCAGCTTTTCTTTCATGAAGACATCGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.90%	16.60%	0.15%	14.39%	NA
All Indica	2759	84.10%	1.80%	0.07%	13.99%	NA
All Japonica	1512	40.90%	44.40%	0.07%	14.62%	NA
Aus	269	58.40%	16.40%	1.12%	24.16%	NA
Indica I	595	95.80%	1.20%	0.00%	3.03%	NA
Indica II	465	77.40%	2.80%	0.22%	19.57%	NA
Indica III	913	79.40%	1.30%	0.00%	19.28%	NA
Indica Intermediate	786	84.70%	2.30%	0.13%	12.85%	NA
Temperate Japonica	767	16.60%	73.00%	0.00%	10.43%	NA
Tropical Japonica	504	67.70%	11.90%	0.20%	20.24%	NA
Japonica Intermediate	241	62.20%	21.60%	0.00%	16.18%	NA
VI/Aromatic	96	93.80%	1.00%	0.00%	5.21%	NA
Intermediate	90	76.70%	18.90%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222231033	T -> C	LOC_Os12g36300.1	upstream_gene_variant ; 4542.0bp to feature; MODIFIER	silent_mutation	Average:63.668; most accessible tissue: Callus, score: 90.905	N	N	N	N
vg1222231033	T -> C	LOC_Os12g36310.1	intron_variant ; MODIFIER	silent_mutation	Average:63.668; most accessible tissue: Callus, score: 90.905	N	N	N	N
vg1222231033	T -> DEL	N	N	silent_mutation	Average:63.668; most accessible tissue: Callus, score: 90.905	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222231033	NA	5.61E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	2.00E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	3.58E-06	mr1404	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	5.18E-06	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	6.28E-07	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	7.94E-06	mr1066_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	4.00E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	1.21E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	2.63E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	1.38E-12	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	2.49E-07	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	1.48E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	2.49E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	4.29E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	9.07E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	7.57E-07	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	1.22E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	2.38E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	5.04E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	1.93E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	4.58E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	6.18E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	8.00E-10	mr1606_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	3.93E-09	mr1607_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	4.88E-06	NA	mr1670_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	1.21E-07	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	1.48E-08	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	2.75E-09	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	3.91E-11	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033	NA	1.99E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251