\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222231033:

Variant ID: vg1222231033 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 22231033
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGATGTCTTCATGAAAGAAAAGCTGAGCAGTATTTGGGATGGCTACAGAGGCTTGTTACAGACAACAGTAAGGACATCAGTTTCACTAATGAACGTTT[T/C]
AAGCTACCTGGAGTGCAACACAGCTAGGGGTTCCTGCATATTCAACATCACATACATCCTAGCTACTGCACTATCTAAAGCTGGGAGTTCAGGTGGTGGT

Reverse complement sequence

ACCACCACCTGAACTCCCAGCTTTAGATAGTGCAGTAGCTAGGATGTATGTGATGTTGAATATGCAGGAACCCCTAGCTGTGTTGCACTCCAGGTAGCTT[A/G]
AAACGTTCATTAGTGAAACTGATGTCCTTACTGTTGTCTGTAACAAGCCTCTGTAGCCATCCCAAATACTGCTCAGCTTTTCTTTCATGAAGACATCGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 16.60% 0.15% 14.39% NA
All Indica  2759 84.10% 1.80% 0.07% 13.99% NA
All Japonica  1512 40.90% 44.40% 0.07% 14.62% NA
Aus  269 58.40% 16.40% 1.12% 24.16% NA
Indica I  595 95.80% 1.20% 0.00% 3.03% NA
Indica II  465 77.40% 2.80% 0.22% 19.57% NA
Indica III  913 79.40% 1.30% 0.00% 19.28% NA
Indica Intermediate  786 84.70% 2.30% 0.13% 12.85% NA
Temperate Japonica  767 16.60% 73.00% 0.00% 10.43% NA
Tropical Japonica  504 67.70% 11.90% 0.20% 20.24% NA
Japonica Intermediate  241 62.20% 21.60% 0.00% 16.18% NA
VI/Aromatic  96 93.80% 1.00% 0.00% 5.21% NA
Intermediate  90 76.70% 18.90% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1222231033 T -> C LOC_Os12g36300.1 upstream_gene_variant ; 4542.0bp to feature; MODIFIER silent_mutation Average:63.668; most accessible tissue: Callus, score: 90.905 N N N N
vg1222231033 T -> C LOC_Os12g36310.1 intron_variant ; MODIFIER silent_mutation Average:63.668; most accessible tissue: Callus, score: 90.905 N N N N
vg1222231033 T -> DEL N N silent_mutation Average:63.668; most accessible tissue: Callus, score: 90.905 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1222231033 NA 5.61E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 2.00E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 3.58E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 5.18E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 6.28E-07 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 7.94E-06 mr1066_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 4.00E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 1.21E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 2.63E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 1.38E-12 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 2.49E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 1.48E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 2.49E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 4.29E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 9.07E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 7.57E-07 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 1.22E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 2.38E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 5.04E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 1.93E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 4.58E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 6.18E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 8.00E-10 mr1606_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 3.93E-09 mr1607_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 4.88E-06 NA mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 1.21E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 1.48E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 2.75E-09 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 3.91E-11 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222231033 NA 1.99E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251