\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220916154:

Variant ID: vg1220916154 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20916154
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, A: 0.28, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


AGCAAAGTCCATGCTGCATCCATGCAACGGCTGGTAAGGTTTTGGACTAGTGGCAGTGCACTCTACTCAATAAAAATTGGCAAAATTTGTTACAGGACAT[C/A]
CAAAAAACTTGTAATTAGCTGGGAGACACCGCAATAACGGGTATTTGCTATAGGGCACCGTAAAAAACTGGTAATTAGCTTCTGGACACTCACCGGATTA

Reverse complement sequence

TAATCCGGTGAGTGTCCAGAAGCTAATTACCAGTTTTTTACGGTGCCCTATAGCAAATACCCGTTATTGCGGTGTCTCCCAGCTAATTACAAGTTTTTTG[G/T]
ATGTCCTGTAACAAATTTTGCCAATTTTTATTGAGTAGAGTGCACTGCCACTAGTCCAAAACCTTACCAGCCGTTGCATGGATGCAGCATGGACTTTGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 38.40% 0.97% 12.27% NA
All Indica  2759 44.90% 44.60% 0.83% 9.68% NA
All Japonica  1512 50.00% 32.60% 0.53% 16.87% NA
Aus  269 77.30% 6.70% 1.86% 14.13% NA
Indica I  595 17.60% 80.70% 0.17% 1.51% NA
Indica II  465 68.00% 25.20% 0.43% 6.45% NA
Indica III  913 46.40% 33.30% 1.42% 18.84% NA
Indica Intermediate  786 50.10% 41.90% 0.89% 7.12% NA
Temperate Japonica  767 75.60% 6.30% 0.52% 17.60% NA
Tropical Japonica  504 9.90% 76.80% 0.60% 12.70% NA
Japonica Intermediate  241 52.30% 24.10% 0.41% 23.24% NA
VI/Aromatic  96 33.30% 41.70% 7.29% 17.71% NA
Intermediate  90 54.40% 38.90% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220916154 C -> DEL N N silent_mutation Average:40.764; most accessible tissue: Callus, score: 52.935 N N N N
vg1220916154 C -> A LOC_Os12g34540.1 downstream_gene_variant ; 1416.0bp to feature; MODIFIER silent_mutation Average:40.764; most accessible tissue: Callus, score: 52.935 N N N N
vg1220916154 C -> A LOC_Os12g34524-LOC_Os12g34540 intergenic_region ; MODIFIER silent_mutation Average:40.764; most accessible tissue: Callus, score: 52.935 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220916154 NA 6.36E-15 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1220916154 NA 2.27E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 6.93E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 4.69E-06 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 1.03E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 9.55E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 1.29E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 9.34E-18 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 4.65E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 1.59E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 5.37E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 7.01E-10 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 1.07E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 1.03E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 1.58E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 4.76E-06 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 2.54E-08 1.27E-26 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 7.99E-06 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 4.98E-06 NA mr1745_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 3.84E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220916154 NA 7.09E-10 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251