\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220866478:

Variant ID: vg1220866478 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20866478
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CTGATTCATGTAAAGGCAAAAAAAATTGAAAAAAACATCTAAAAAAGTTCGTCCGATTCCCTAAGAAAGTGGCAAAAAAATGGGTCGTAAAAAATAAAAA[A/G]
CTGGTTCGTATAAAATAAAAATTGCACGCGAGAAAAAATGGAAAGGGTGAAACAAAGTCCAATTTCTAATCAGTATAAATCTCTTCTCTATCTCTAGTCT

Reverse complement sequence

AGACTAGAGATAGAGAAGAGATTTATACTGATTAGAAATTGGACTTTGTTTCACCCTTTCCATTTTTTCTCGCGTGCAATTTTTATTTTATACGAACCAG[T/C]
TTTTTATTTTTTACGACCCATTTTTTTGCCACTTTCTTAGGGAATCGGACGAACTTTTTTAGATGTTTTTTTCAATTTTTTTTGCCTTTACATGAATCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.80% 18.70% 51.97% 2.60% NA
All Indica  2759 24.90% 5.40% 66.15% 3.55% NA
All Japonica  1512 30.50% 46.00% 22.02% 1.46% NA
Aus  269 18.20% 2.60% 79.18% 0.00% NA
Indica I  595 30.40% 1.50% 63.03% 5.04% NA
Indica II  465 22.60% 4.50% 64.95% 7.96% NA
Indica III  913 24.60% 9.30% 65.50% 0.55% NA
Indica Intermediate  786 22.50% 4.20% 69.97% 3.31% NA
Temperate Japonica  767 21.00% 73.70% 4.82% 0.52% NA
Tropical Japonica  504 43.80% 7.90% 45.24% 2.98% NA
Japonica Intermediate  241 32.80% 37.80% 28.22% 1.24% NA
VI/Aromatic  96 44.80% 5.20% 50.00% 0.00% NA
Intermediate  90 26.70% 28.90% 41.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220866478 A -> DEL N N silent_mutation Average:19.61; most accessible tissue: Callus, score: 36.97 N N N N
vg1220866478 A -> G LOC_Os12g34450.1 upstream_gene_variant ; 1323.0bp to feature; MODIFIER silent_mutation Average:19.61; most accessible tissue: Callus, score: 36.97 N N N N
vg1220866478 A -> G LOC_Os12g34460.2 upstream_gene_variant ; 2939.0bp to feature; MODIFIER silent_mutation Average:19.61; most accessible tissue: Callus, score: 36.97 N N N N
vg1220866478 A -> G LOC_Os12g34440.1 downstream_gene_variant ; 3476.0bp to feature; MODIFIER silent_mutation Average:19.61; most accessible tissue: Callus, score: 36.97 N N N N
vg1220866478 A -> G LOC_Os12g34440-LOC_Os12g34450 intergenic_region ; MODIFIER silent_mutation Average:19.61; most accessible tissue: Callus, score: 36.97 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220866478 1.70E-07 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220866478 NA 7.78E-13 mr1790 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220866478 NA 5.33E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220866478 NA 2.70E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220866478 1.35E-08 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251