\
| Variant ID: vg1220866478 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20866478 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 109. )
CTGATTCATGTAAAGGCAAAAAAAATTGAAAAAAACATCTAAAAAAGTTCGTCCGATTCCCTAAGAAAGTGGCAAAAAAATGGGTCGTAAAAAATAAAAA[A/G]
CTGGTTCGTATAAAATAAAAATTGCACGCGAGAAAAAATGGAAAGGGTGAAACAAAGTCCAATTTCTAATCAGTATAAATCTCTTCTCTATCTCTAGTCT
AGACTAGAGATAGAGAAGAGATTTATACTGATTAGAAATTGGACTTTGTTTCACCCTTTCCATTTTTTCTCGCGTGCAATTTTTATTTTATACGAACCAG[T/C]
TTTTTATTTTTTACGACCCATTTTTTTGCCACTTTCTTAGGGAATCGGACGAACTTTTTTAGATGTTTTTTTCAATTTTTTTTGCCTTTACATGAATCAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.80% | 18.70% | 51.97% | 2.60% | NA |
| All Indica | 2759 | 24.90% | 5.40% | 66.15% | 3.55% | NA |
| All Japonica | 1512 | 30.50% | 46.00% | 22.02% | 1.46% | NA |
| Aus | 269 | 18.20% | 2.60% | 79.18% | 0.00% | NA |
| Indica I | 595 | 30.40% | 1.50% | 63.03% | 5.04% | NA |
| Indica II | 465 | 22.60% | 4.50% | 64.95% | 7.96% | NA |
| Indica III | 913 | 24.60% | 9.30% | 65.50% | 0.55% | NA |
| Indica Intermediate | 786 | 22.50% | 4.20% | 69.97% | 3.31% | NA |
| Temperate Japonica | 767 | 21.00% | 73.70% | 4.82% | 0.52% | NA |
| Tropical Japonica | 504 | 43.80% | 7.90% | 45.24% | 2.98% | NA |
| Japonica Intermediate | 241 | 32.80% | 37.80% | 28.22% | 1.24% | NA |
| VI/Aromatic | 96 | 44.80% | 5.20% | 50.00% | 0.00% | NA |
| Intermediate | 90 | 26.70% | 28.90% | 41.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220866478 | A -> DEL | N | N | silent_mutation | Average:19.61; most accessible tissue: Callus, score: 36.97 | N | N | N | N |
| vg1220866478 | A -> G | LOC_Os12g34450.1 | upstream_gene_variant ; 1323.0bp to feature; MODIFIER | silent_mutation | Average:19.61; most accessible tissue: Callus, score: 36.97 | N | N | N | N |
| vg1220866478 | A -> G | LOC_Os12g34460.2 | upstream_gene_variant ; 2939.0bp to feature; MODIFIER | silent_mutation | Average:19.61; most accessible tissue: Callus, score: 36.97 | N | N | N | N |
| vg1220866478 | A -> G | LOC_Os12g34440.1 | downstream_gene_variant ; 3476.0bp to feature; MODIFIER | silent_mutation | Average:19.61; most accessible tissue: Callus, score: 36.97 | N | N | N | N |
| vg1220866478 | A -> G | LOC_Os12g34440-LOC_Os12g34450 | intergenic_region ; MODIFIER | silent_mutation | Average:19.61; most accessible tissue: Callus, score: 36.97 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220866478 | 1.70E-07 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220866478 | NA | 7.78E-13 | mr1790 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220866478 | NA | 5.33E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220866478 | NA | 2.70E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220866478 | 1.35E-08 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |