RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1220336354:

Variant ID: vg1220336354 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20336354
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGTTTTTGTATTTAGGTTTGTTGCTTGTGGGTTAGTCGGCGGTCGATTTCATGTGTGAGTGGTATGACAGCCTTAATTAGGAATTGCGTGCCTCTTTT[T/C]
CAGTGTTTTAATCAAGATTAAGATAGTTGCACTTAAATTTATAAGAAAGATTAGTTTCCGAGCCATCTGTTTTCTTCCTTTCTCTTATTTCTACCTATGC

Reverse complement sequence

GCATAGGTAGAAATAAGAGAAAGGAAGAAAACAGATGGCTCGGAAACTAATCTTTCTTATAAATTTAAGTGCAACTATCTTAATCTTGATTAAAACACTG[A/G]
AAAAGAGGCACGCAATTCCTAATTAAGGCTGTCATACCACTCACACATGAAATCGACCGCCGACTAACCCACAAGCAACAAACCTAAATACAAAAACTAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.50%	11.30%	3.68%	39.48%	NA
All Indica	2759	34.30%	12.50%	3.04%	50.09%	NA
All Japonica	1512	71.20%	0.30%	3.31%	25.13%	NA
Aus	269	23.00%	62.50%	6.32%	8.18%	NA
Indica I	595	55.50%	9.10%	2.69%	32.77%	NA
Indica II	465	36.10%	18.10%	1.94%	43.87%	NA
Indica III	913	16.50%	10.60%	3.94%	68.89%	NA
Indica Intermediate	786	37.90%	14.10%	2.93%	45.04%	NA
Temperate Japonica	767	95.00%	0.00%	0.39%	4.56%	NA
Tropical Japonica	504	35.30%	1.00%	8.33%	55.36%	NA
Japonica Intermediate	241	70.50%	0.00%	2.07%	27.39%	NA
VI/Aromatic	96	14.60%	7.30%	17.71%	60.42%	NA
Intermediate	90	56.70%	10.00%	6.67%	26.67%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220336354	T -> C	LOC_Os12g33690.1	upstream_gene_variant ; 109.0bp to feature; MODIFIER	silent_mutation	Average:11.208; most accessible tissue: Callus, score: 24.523	N	N	N	N
vg1220336354	T -> C	LOC_Os12g33680.1	downstream_gene_variant ; 3832.0bp to feature; MODIFIER	silent_mutation	Average:11.208; most accessible tissue: Callus, score: 24.523	N	N	N	N
vg1220336354	T -> C	LOC_Os12g33680-LOC_Os12g33690	intergenic_region ; MODIFIER	silent_mutation	Average:11.208; most accessible tissue: Callus, score: 24.523	N	N	N	N
vg1220336354	T -> DEL	N	N	silent_mutation	Average:11.208; most accessible tissue: Callus, score: 24.523	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220336354	3.66E-09	1.51E-18	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354	1.69E-09	4.29E-18	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354	NA	6.55E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354	2.48E-06	4.95E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354	NA	5.14E-06	mr1610	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354	NA	1.01E-06	mr1649	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354	2.59E-06	7.74E-10	mr1818	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354	2.89E-09	2.45E-54	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354	5.92E-10	6.72E-35	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354	NA	2.33E-14	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 31 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg1220336354:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact