\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220336354:

Variant ID: vg1220336354 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 20336354
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGTTTTTGTATTTAGGTTTGTTGCTTGTGGGTTAGTCGGCGGTCGATTTCATGTGTGAGTGGTATGACAGCCTTAATTAGGAATTGCGTGCCTCTTTT[T/C]
CAGTGTTTTAATCAAGATTAAGATAGTTGCACTTAAATTTATAAGAAAGATTAGTTTCCGAGCCATCTGTTTTCTTCCTTTCTCTTATTTCTACCTATGC

Reverse complement sequence

GCATAGGTAGAAATAAGAGAAAGGAAGAAAACAGATGGCTCGGAAACTAATCTTTCTTATAAATTTAAGTGCAACTATCTTAATCTTGATTAAAACACTG[A/G]
AAAAGAGGCACGCAATTCCTAATTAAGGCTGTCATACCACTCACACATGAAATCGACCGCCGACTAACCCACAAGCAACAAACCTAAATACAAAAACTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.50% 11.30% 3.68% 39.48% NA
All Indica  2759 34.30% 12.50% 3.04% 50.09% NA
All Japonica  1512 71.20% 0.30% 3.31% 25.13% NA
Aus  269 23.00% 62.50% 6.32% 8.18% NA
Indica I  595 55.50% 9.10% 2.69% 32.77% NA
Indica II  465 36.10% 18.10% 1.94% 43.87% NA
Indica III  913 16.50% 10.60% 3.94% 68.89% NA
Indica Intermediate  786 37.90% 14.10% 2.93% 45.04% NA
Temperate Japonica  767 95.00% 0.00% 0.39% 4.56% NA
Tropical Japonica  504 35.30% 1.00% 8.33% 55.36% NA
Japonica Intermediate  241 70.50% 0.00% 2.07% 27.39% NA
VI/Aromatic  96 14.60% 7.30% 17.71% 60.42% NA
Intermediate  90 56.70% 10.00% 6.67% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1220336354 T -> C LOC_Os12g33690.1 upstream_gene_variant ; 109.0bp to feature; MODIFIER silent_mutation Average:11.208; most accessible tissue: Callus, score: 24.523 N N N N
vg1220336354 T -> C LOC_Os12g33680.1 downstream_gene_variant ; 3832.0bp to feature; MODIFIER silent_mutation Average:11.208; most accessible tissue: Callus, score: 24.523 N N N N
vg1220336354 T -> C LOC_Os12g33680-LOC_Os12g33690 intergenic_region ; MODIFIER silent_mutation Average:11.208; most accessible tissue: Callus, score: 24.523 N N N N
vg1220336354 T -> DEL N N silent_mutation Average:11.208; most accessible tissue: Callus, score: 24.523 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1220336354 3.66E-09 1.51E-18 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 1.69E-09 4.29E-18 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 NA 6.55E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 2.48E-06 4.95E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 NA 5.14E-06 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 NA 1.01E-06 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 2.59E-06 7.74E-10 mr1818 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 2.89E-09 2.45E-54 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 5.92E-10 6.72E-35 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 NA 2.33E-14 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 NA 2.91E-07 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 3.43E-06 2.77E-12 mr1927 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 NA 3.02E-07 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 NA 5.64E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 NA 5.54E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 2.12E-07 1.78E-21 mr1317_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 5.01E-07 8.04E-20 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 NA 1.01E-14 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 NA 9.48E-12 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 2.58E-06 1.43E-18 mr1610_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 5.12E-06 6.72E-13 mr1610_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 1.08E-07 1.21E-23 mr1818_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 8.79E-08 1.97E-16 mr1818_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 1.42E-08 1.03E-59 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 2.44E-08 8.32E-35 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 1.85E-06 2.88E-22 mr1897_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 NA 1.68E-13 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 1.26E-06 1.64E-24 mr1914_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 1.06E-06 3.53E-20 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 1.22E-07 9.63E-29 mr1927_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220336354 7.12E-07 3.10E-20 mr1927_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251