\
| Variant ID: vg1220336226 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20336226 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, others allele: 0.00, population size: 68. )
TTTGAGCATGCATTGATTCCTATCCCTTGTCTACCTTAGAAGTCAGACCTGTTCTTCGATCGCAAGCGCTGCTCCGAGCTTTAGAGTCGCCACCCTTAGC[T/C]
TTATCGTCTTCTTAGTCTGTTTGCTTGCTAGTTTTTGTATTTAGGTTTGTTGCTTGTGGGTTAGTCGGCGGTCGATTTCATGTGTGAGTGGTATGACAGC
GCTGTCATACCACTCACACATGAAATCGACCGCCGACTAACCCACAAGCAACAAACCTAAATACAAAAACTAGCAAGCAAACAGACTAAGAAGACGATAA[A/G]
GCTAAGGGTGGCGACTCTAAAGCTCGGAGCAGCGCTTGCGATCGAAGAACAGGTCTGACTTCTAAGGTAGACAAGGGATAGGAATCAATGCATGCTCAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.20% | 10.50% | 1.90% | 32.42% | NA |
| All Indica | 2759 | 34.90% | 11.90% | 2.32% | 50.85% | NA |
| All Japonica | 1512 | 94.40% | 0.10% | 0.26% | 5.16% | NA |
| Aus | 269 | 29.40% | 56.10% | 6.32% | 8.18% | NA |
| Indica I | 595 | 56.50% | 8.40% | 1.68% | 33.45% | NA |
| Indica II | 465 | 35.90% | 17.20% | 2.80% | 44.09% | NA |
| Indica III | 913 | 17.30% | 10.00% | 2.63% | 70.10% | NA |
| Indica Intermediate | 786 | 38.50% | 13.60% | 2.16% | 45.67% | NA |
| Temperate Japonica | 767 | 97.90% | 0.00% | 0.13% | 1.96% | NA |
| Tropical Japonica | 504 | 88.50% | 0.40% | 0.20% | 10.91% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.00% | 0.83% | 3.32% | NA |
| VI/Aromatic | 96 | 79.20% | 6.20% | 5.21% | 9.38% | NA |
| Intermediate | 90 | 70.00% | 7.80% | 0.00% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220336226 | T -> C | LOC_Os12g33690.1 | upstream_gene_variant ; 237.0bp to feature; MODIFIER | silent_mutation | Average:14.723; most accessible tissue: Callus, score: 44.232 | N | N | N | N |
| vg1220336226 | T -> C | LOC_Os12g33680.1 | downstream_gene_variant ; 3704.0bp to feature; MODIFIER | silent_mutation | Average:14.723; most accessible tissue: Callus, score: 44.232 | N | N | N | N |
| vg1220336226 | T -> C | LOC_Os12g33680-LOC_Os12g33690 | intergenic_region ; MODIFIER | silent_mutation | Average:14.723; most accessible tissue: Callus, score: 44.232 | N | N | N | N |
| vg1220336226 | T -> DEL | N | N | silent_mutation | Average:14.723; most accessible tissue: Callus, score: 44.232 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220336226 | NA | 5.48E-06 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | 1.31E-06 | 1.80E-14 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | 9.05E-06 | 4.61E-13 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | NA | 1.62E-07 | mr1649 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | NA | 4.56E-06 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | NA | 1.71E-06 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | 1.98E-08 | 2.34E-47 | mr1855 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | 3.67E-08 | 1.35E-27 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | NA | 1.49E-11 | mr1897 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | 3.70E-06 | 8.89E-19 | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | NA | 7.44E-16 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | 2.60E-06 | 1.06E-15 | mr1608_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | 6.99E-06 | 1.64E-12 | mr1608_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | NA | 7.51E-15 | mr1610_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | NA | 8.26E-11 | mr1610_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | 4.23E-06 | 4.92E-21 | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | NA | 1.07E-13 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | 3.30E-08 | 8.32E-51 | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | 2.18E-07 | 1.79E-25 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | NA | 6.24E-19 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | NA | 1.55E-10 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | NA | 3.36E-20 | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | NA | 1.23E-14 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | 3.51E-07 | 4.84E-25 | mr1927_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220336226 | NA | 9.20E-16 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |