Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219910677:

Variant ID: vg1219910677 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19910677
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.52, T: 0.48, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


GTCACGTCCAACCAAAATTATTTATATTTAGGATGGAGGGAGGGAGTATTAAACAGGCGATTTGGTCGTCGGCAAATCTGACTTAATTATTATCATCCAC[A/T]
GCCATAAGCCCATAACAGTTATTACCAACGATTTAACGAACTTAATTACGTGTCAGTGAGCCAGTCTCGCTTAATTTAATTCTGAAACTACAAAGAAATT

Reverse complement sequence

AATTTCTTTGTAGTTTCAGAATTAAATTAAGCGAGACTGGCTCACTGACACGTAATTAAGTTCGTTAAATCGTTGGTAATAACTGTTATGGGCTTATGGC[T/A]
GTGGATGATAATAATTAAGTCAGATTTGCCGACGACCAAATCGCCTGTTTAATACTCCCTCCCTCCATCCTAAATATAAATAATTTTGGTTGGACGTGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 36.20% 0.08% 0.00% NA
All Indica  2759 96.20% 3.80% 0.07% 0.00% NA
All Japonica  1512 3.90% 96.10% 0.00% 0.00% NA
Aus  269 93.30% 6.30% 0.37% 0.00% NA
Indica I  595 97.50% 2.40% 0.17% 0.00% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 98.00% 2.00% 0.00% 0.00% NA
Indica Intermediate  786 93.30% 6.60% 0.13% 0.00% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 34.40% 64.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219910677 A -> T LOC_Os12g32970.1 3_prime_UTR_variant ; 133.0bp to feature; MODIFIER silent_mutation Average:89.309; most accessible tissue: Minghui63 root, score: 96.429 N N N N
vg1219910677 A -> T LOC_Os12g32950.1 upstream_gene_variant ; 4345.0bp to feature; MODIFIER silent_mutation Average:89.309; most accessible tissue: Minghui63 root, score: 96.429 N N N N
vg1219910677 A -> T LOC_Os12g32960.1 downstream_gene_variant ; 2133.0bp to feature; MODIFIER silent_mutation Average:89.309; most accessible tissue: Minghui63 root, score: 96.429 N N N N
vg1219910677 A -> T LOC_Os12g32980.1 downstream_gene_variant ; 3630.0bp to feature; MODIFIER silent_mutation Average:89.309; most accessible tissue: Minghui63 root, score: 96.429 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1219910677 A T 0.01 -0.02 -0.03 -0.03 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219910677 NA 2.74E-21 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 1.31E-06 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 4.22E-15 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 2.93E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 4.22E-15 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 3.65E-51 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 6.84E-29 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 2.65E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 2.75E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 7.05E-17 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 6.33E-16 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 6.70E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 2.18E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 1.61E-19 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 1.17E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 4.73E-22 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 5.27E-10 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 3.11E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 4.96E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 1.67E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 1.29E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910677 NA 2.29E-40 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251