Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219801760:

Variant ID: vg1219801760 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19801760
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CACCTCAAAATTTTACACCTTATCACATCGAAAGTTTGAACTTCTGCGTGAAGTATTAAATATAGGCTAGAAAAGTAACTAATTGCACAAATTGTGACTA[C/T]
TTTGCGAGACGAATCTTTTAAGCCTAATTGCTCTATGATTTGACATGTTGTGCTACAGTAAACATGTGCTAATAACGGACTAATTAGGCTTAATAAATTT

Reverse complement sequence

AAATTTATTAAGCCTAATTAGTCCGTTATTAGCACATGTTTACTGTAGCACAACATGTCAAATCATAGAGCAATTAGGCTTAAAAGATTCGTCTCGCAAA[G/A]
TAGTCACAATTTGTGCAATTAGTTACTTTTCTAGCCTATATTTAATACTTCACGCAGAAGTTCAAACTTTCGATGTGATAAGGTGTAAAATTTTGAGGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.70% 17.20% 0.11% 0.00% NA
All Indica  2759 74.60% 25.30% 0.14% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 68.80% 30.90% 0.37% 0.00% NA
Indica I  595 89.10% 10.90% 0.00% 0.00% NA
Indica II  465 46.00% 54.00% 0.00% 0.00% NA
Indica III  913 82.30% 17.50% 0.22% 0.00% NA
Indica Intermediate  786 71.50% 28.20% 0.25% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219801760 C -> T LOC_Os12g32790.1 upstream_gene_variant ; 4176.0bp to feature; MODIFIER silent_mutation Average:56.132; most accessible tissue: Minghui63 flag leaf, score: 84.608 N N N N
vg1219801760 C -> T LOC_Os12g32770-LOC_Os12g32790 intergenic_region ; MODIFIER silent_mutation Average:56.132; most accessible tissue: Minghui63 flag leaf, score: 84.608 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219801760 NA 3.42E-09 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 6.19E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 4.07E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 2.01E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 3.79E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 9.34E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 1.78E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 6.93E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 2.48E-10 mr1232_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 7.41E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 6.52E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 7.07E-06 mr1500_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 9.76E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 2.11E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 8.22E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 6.55E-06 6.04E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 5.78E-07 mr1790_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 1.86E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 2.86E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 3.56E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 1.04E-06 mr1915_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219801760 NA 4.00E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251