\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219227451:

Variant ID: vg1219227451 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19227451
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCATATCTATCAATTGGAATTGGCTTGGATTCCGGAAAAGGGGAAAATATGTTGTGCAAACCACATATGTAGTGGAAACTTGGAAACTACTATTGGAT[C/T]
GAGAAATAGATGCCCGAGATTCGTCCACGTCACCATGAGTTAAAATTTAACTCCCAGTAAAATTTTAACTCATGAGTGAATCTGCGAGTTAAATTTTAAC

Reverse complement sequence

GTTAAAATTTAACTCGCAGATTCACTCATGAGTTAAAATTTTACTGGGAGTTAAATTTTAACTCATGGTGACGTGGACGAATCTCGGGCATCTATTTCTC[G/A]
ATCCAATAGTAGTTTCCAAGTTTCCACTACATATGTGGTTTGCACAACATATTTTCCCCTTTTCCGGAATCCAAGCCAATTCCAATTGATAGATATGCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.60% 7.90% 0.42% 54.99% NA
All Indica  2759 4.50% 11.90% 0.58% 83.00% NA
All Japonica  1512 96.60% 0.30% 0.07% 3.11% NA
Aus  269 2.20% 13.00% 0.74% 84.01% NA
Indica I  595 4.50% 9.40% 0.17% 85.88% NA
Indica II  465 3.00% 18.90% 1.29% 76.77% NA
Indica III  913 2.60% 11.80% 0.44% 85.10% NA
Indica Intermediate  786 7.50% 9.80% 0.64% 82.06% NA
Temperate Japonica  767 98.30% 0.00% 0.13% 1.56% NA
Tropical Japonica  504 97.60% 0.00% 0.00% 2.38% NA
Japonica Intermediate  241 88.80% 1.70% 0.00% 9.54% NA
VI/Aromatic  96 84.40% 3.10% 0.00% 12.50% NA
Intermediate  90 67.80% 4.40% 1.11% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219227451 C -> DEL N N silent_mutation Average:28.327; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg1219227451 C -> T LOC_Os12g31910.1 upstream_gene_variant ; 855.0bp to feature; MODIFIER silent_mutation Average:28.327; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg1219227451 C -> T LOC_Os12g31900-LOC_Os12g31910 intergenic_region ; MODIFIER silent_mutation Average:28.327; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219227451 NA 5.75E-07 mr1106 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 NA 3.98E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 NA 9.98E-06 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 NA 3.43E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 NA 2.93E-07 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 NA 8.66E-10 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 NA 7.57E-12 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 NA 4.42E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 NA 5.23E-06 mr1248_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 NA 2.79E-09 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 NA 1.74E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 3.73E-06 8.68E-22 mr1255_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 3.11E-06 3.66E-10 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 NA 6.46E-12 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 NA 1.29E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227451 NA 3.30E-09 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251