\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218842150:

Variant ID: vg1218842150 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18842150
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGAGATGACGTGGGGTCTCTGATCCAGTTCTCTCTGAAAAACCTCGGGAACGCCAGAACTCCTCTCGCTGCTGATAACGTTACGTTCAGAGTGCATGA[G/A]
GACTAGAGTTCATGGAACAGGTGTTACTATTGTTAGTAACCTAATACTGGGCCATGACTAAGCTAATGATTATTGGCAAGTCATGGACTGTGGGTAAAGC

Reverse complement sequence

GCTTTACCCACAGTCCATGACTTGCCAATAATCATTAGCTTAGTCATGGCCCAGTATTAGGTTACTAACAATAGTAACACCTGTTCCATGAACTCTAGTC[C/T]
TCATGCACTCTGAACGTAACGTTATCAGCAGCGAGAGGAGTTCTGGCGTTCCCGAGGTTTTTCAGAGAGAACTGGATCAGAGACCCCACGTCATCTCAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.20% 37.60% 3.07% 19.11% NA
All Indica  2759 11.60% 63.10% 4.10% 21.24% NA
All Japonica  1512 93.10% 0.70% 0.07% 6.08% NA
Aus  269 19.30% 1.50% 7.06% 72.12% NA
Indica I  595 5.70% 73.10% 2.18% 18.99% NA
Indica II  465 21.30% 65.40% 1.51% 11.83% NA
Indica III  913 8.90% 60.60% 6.35% 24.21% NA
Indica Intermediate  786 13.40% 57.10% 4.45% 25.06% NA
Temperate Japonica  767 98.00% 0.90% 0.00% 1.04% NA
Tropical Japonica  504 94.80% 0.40% 0.00% 4.76% NA
Japonica Intermediate  241 73.90% 0.80% 0.41% 24.90% NA
VI/Aromatic  96 65.60% 2.10% 12.50% 19.79% NA
Intermediate  90 66.70% 20.00% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218842150 G -> DEL N N silent_mutation Average:33.342; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg1218842150 G -> A LOC_Os12g31320.1 upstream_gene_variant ; 2688.0bp to feature; MODIFIER silent_mutation Average:33.342; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg1218842150 G -> A LOC_Os12g31310.1 downstream_gene_variant ; 1614.0bp to feature; MODIFIER silent_mutation Average:33.342; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg1218842150 G -> A LOC_Os12g31330.1 downstream_gene_variant ; 4885.0bp to feature; MODIFIER silent_mutation Average:33.342; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg1218842150 G -> A LOC_Os12g31310-LOC_Os12g31320 intergenic_region ; MODIFIER silent_mutation Average:33.342; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218842150 NA 5.94E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 1.30E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 3.20E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 8.30E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 1.86E-15 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 2.24E-07 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 7.33E-12 1.35E-67 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 1.59E-08 5.38E-20 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 7.69E-06 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 2.36E-06 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 4.14E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 1.96E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 4.07E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 1.01E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 3.16E-09 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 1.15E-18 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 9.29E-15 mr1220_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 8.13E-08 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 7.72E-06 mr1230_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 1.53E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 2.81E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 8.76E-09 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 3.21E-06 mr1388_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 1.52E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 2.77E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 3.90E-06 7.87E-26 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 2.20E-08 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 1.05E-09 1.42E-68 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 8.80E-07 6.57E-18 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 8.27E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 6.64E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 5.33E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218842150 NA 6.79E-10 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251