| Variant ID: vg1218169236 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18169236 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.29, others allele: 0.00, population size: 76. )
CAACTTGTAAGGTCGTGAGACCTAGATTTGTGAATTGGGCGTTATGTGACTCCTGTCGGTGAAGTGCGTTGAATCCCACACTCCTAGCAGGCGTAGAGTT[C/T]
AGCTTTCACGTGGAGTATCACCGGGCAATCCTCGAGAATATACTTGGATGTCAGCTTTTAGGTAGTATTCCTTGTCAGCTCTGGTTTTTGTACAAGGGAC
GTCCCTTGTACAAAAACCAGAGCTGACAAGGAATACTACCTAAAAGCTGACATCCAAGTATATTCTCGAGGATTGCCCGGTGATACTCCACGTGAAAGCT[G/A]
AACTCTACGCCTGCTAGGAGTGTGGGATTCAACGCACTTCACCGACAGGAGTCACATAACGCCCAATTCACAAATCTAGGTCTCACGACCTTACAAGTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.80% | 21.00% | 2.69% | 15.53% | NA |
| All Indica | 2759 | 68.60% | 3.90% | 4.28% | 23.27% | NA |
| All Japonica | 1512 | 49.10% | 50.60% | 0.00% | 0.26% | NA |
| Aus | 269 | 61.00% | 7.10% | 2.23% | 29.74% | NA |
| Indica I | 595 | 90.40% | 3.20% | 0.50% | 5.88% | NA |
| Indica II | 465 | 61.30% | 4.30% | 8.60% | 25.81% | NA |
| Indica III | 913 | 62.50% | 2.00% | 4.27% | 31.22% | NA |
| Indica Intermediate | 786 | 63.40% | 6.40% | 4.58% | 25.70% | NA |
| Temperate Japonica | 767 | 63.00% | 36.60% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 26.60% | 73.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 52.30% | 47.30% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 24.00% | 70.80% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 57.80% | 35.60% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218169236 | C -> DEL | N | N | silent_mutation | Average:42.011; most accessible tissue: Callus, score: 58.158 | N | N | N | N |
| vg1218169236 | C -> T | LOC_Os12g30280.1 | upstream_gene_variant ; 3487.0bp to feature; MODIFIER | silent_mutation | Average:42.011; most accessible tissue: Callus, score: 58.158 | N | N | N | N |
| vg1218169236 | C -> T | LOC_Os12g30290.1 | upstream_gene_variant ; 192.0bp to feature; MODIFIER | silent_mutation | Average:42.011; most accessible tissue: Callus, score: 58.158 | N | N | N | N |
| vg1218169236 | C -> T | LOC_Os12g30290-LOC_Os12g30310 | intergenic_region ; MODIFIER | silent_mutation | Average:42.011; most accessible tissue: Callus, score: 58.158 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218169236 | NA | 1.42E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169236 | 4.07E-06 | NA | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169236 | 7.35E-06 | NA | mr1046 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169236 | 2.70E-08 | 3.54E-06 | mr1060 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169236 | NA | 5.53E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169236 | NA | 2.58E-11 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169236 | NA | 2.08E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169236 | NA | 7.45E-06 | mr1171 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169236 | 2.47E-06 | NA | mr1179 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218169236 | NA | 2.06E-13 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/