\
| Variant ID: vg1218097299 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18097299 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 97. )
TAGCCTGTTGCCCAAATGTGCACGTCACATAGGTGGTGTTTGGATCAGGGACTTAACTTTAGTCTTTATATTTATATACTAATTTAAAGTATTAAATATA[G/T]
ACTACTTACAAAACTAATTACATAAATGAAAGCTAATTCATGAGACAAATTTTTAAAACCTAATTAATCCATAATTAGAAAATGTTTACTCTAGCATCAC
GTGATGCTAGAGTAAACATTTTCTAATTATGGATTAATTAGGTTTTAAAAATTTGTCTCATGAATTAGCTTTCATTTATGTAATTAGTTTTGTAAGTAGT[C/A]
TATATTTAATACTTTAAATTAGTATATAAATATAAAGACTAAAGTTAAGTCCCTGATCCAAACACCACCTATGTGACGTGCACATTTGGGCAACAGGCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.60% | 26.30% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 66.20% | 33.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 29.70% | 70.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 56.80% | 43.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 49.40% | 50.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 67.20% | 32.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.00% | 22.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 70.80% | 28.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218097299 | G -> T | LOC_Os12g30150.1 | upstream_gene_variant ; 1376.0bp to feature; MODIFIER | silent_mutation | Average:43.92; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg1218097299 | G -> T | LOC_Os12g30140-LOC_Os12g30150 | intergenic_region ; MODIFIER | silent_mutation | Average:43.92; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218097299 | NA | 3.18E-15 | mr1232 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218097299 | NA | 6.53E-06 | mr1232 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218097299 | NA | 1.63E-09 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218097299 | NA | 1.39E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218097299 | NA | 7.82E-06 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218097299 | NA | 5.57E-08 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |