Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1217693047:

Variant ID: vg1217693047 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17693047
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, G: 0.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTAAGGATAAGCACCCTAATTGCAGGTACACGTTTGGGCCGGAAAAGTAGACGTTCCAGCACAGGTAATGAGAAAGCAGCTGTCTATAAAGAGTTCAA[T/G]
TAAGCTAAAGATAGATACTGATTCAAAATGCTCCCAAAGGGAAGTTTTTGTTAATTATATATACCTTCCCAGATCCTGTTATAGCACTGCCACATATATC

Reverse complement sequence

GATATATGTGGCAGTGCTATAACAGGATCTGGGAAGGTATATATAATTAACAAAAACTTCCCTTTGGGAGCATTTTGAATCAGTATCTATCTTTAGCTTA[A/C]
TTGAACTCTTTATAGACAGCTGCTTTCTCATTACCTGTGCTGGAACGTCTACTTTTCCGGCCCAAACGTGTACCTGCAATTAGGGTGCTTATCCTTACTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 10.60% 0.08% 1.10% NA
All Indica  2759 94.40% 3.80% 0.07% 1.74% NA
All Japonica  1512 80.90% 18.70% 0.13% 0.26% NA
Aus  269 69.90% 30.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 86.90% 9.00% 0.00% 4.16% NA
Indica Intermediate  786 95.90% 2.50% 0.25% 1.27% NA
Temperate Japonica  767 98.00% 2.00% 0.00% 0.00% NA
Tropical Japonica  504 64.70% 35.10% 0.20% 0.00% NA
Japonica Intermediate  241 60.20% 37.80% 0.41% 1.66% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217693047 T -> DEL N N silent_mutation Average:46.747; most accessible tissue: Callus, score: 76.627 N N N N
vg1217693047 T -> G LOC_Os12g29670.1 upstream_gene_variant ; 1996.0bp to feature; MODIFIER silent_mutation Average:46.747; most accessible tissue: Callus, score: 76.627 N N N N
vg1217693047 T -> G LOC_Os12g29660.1 intron_variant ; MODIFIER silent_mutation Average:46.747; most accessible tissue: Callus, score: 76.627 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217693047 4.75E-06 NA mr1748 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251