Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216993343:

Variant ID: vg1216993343 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16993343
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


TTTACCCGAGGATCTTTAAACACACCACTACTAGGGCTGTGTTTAGTTCACGCAAAGTTTGGATTTTGGTTGAAATTAGAGATGATGTGACTGAAAATTT[G/A]
TGTGTGTATGACAGGTTGATGTGATGAAAAACTACAGAAGTTTGGATCCAAACTGGATCTAAACACAGCCTAGAGGAGGAGGATCCGGTGCGTAACAGGG

Reverse complement sequence

CCCTGTTACGCACCGGATCCTCCTCCTCTAGGCTGTGTTTAGATCCAGTTTGGATCCAAACTTCTGTAGTTTTTCATCACATCAACCTGTCATACACACA[C/T]
AAATTTTCAGTCACATCATCTCTAATTTCAACCAAAATCCAAACTTTGCGTGAACTAAACACAGCCCTAGTAGTGGTGTGTTTAAAGATCCTCGGGTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.40% 23.40% 1.27% 44.96% NA
All Indica  2759 11.30% 22.00% 1.01% 65.68% NA
All Japonica  1512 68.40% 28.80% 1.85% 0.93% NA
Aus  269 16.40% 2.20% 0.37% 81.04% NA
Indica I  595 11.80% 7.20% 2.52% 78.49% NA
Indica II  465 7.50% 51.40% 0.22% 40.86% NA
Indica III  913 12.70% 13.90% 0.22% 73.17% NA
Indica Intermediate  786 11.70% 25.10% 1.27% 61.96% NA
Temperate Japonica  767 89.60% 9.50% 0.39% 0.52% NA
Tropical Japonica  504 36.90% 61.90% 0.20% 0.99% NA
Japonica Intermediate  241 66.80% 21.20% 9.96% 2.07% NA
VI/Aromatic  96 12.50% 27.10% 1.04% 59.38% NA
Intermediate  90 35.60% 35.60% 2.22% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216993343 G -> DEL N N silent_mutation Average:76.325; most accessible tissue: Minghui63 panicle, score: 97.837 N N N N
vg1216993343 G -> A LOC_Os12g28750.1 downstream_gene_variant ; 2476.0bp to feature; MODIFIER silent_mutation Average:76.325; most accessible tissue: Minghui63 panicle, score: 97.837 N N N N
vg1216993343 G -> A LOC_Os12g28750-LOC_Os12g28760 intergenic_region ; MODIFIER silent_mutation Average:76.325; most accessible tissue: Minghui63 panicle, score: 97.837 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1216993343 G A 0.0 -0.01 -0.02 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216993343 NA 4.14E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 2.84E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 2.07E-08 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 2.11E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 7.47E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 2.57E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 6.09E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 1.28E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 2.22E-15 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 5.91E-06 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 1.09E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 4.60E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 7.06E-06 mr1257 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 1.88E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 5.84E-15 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 1.61E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 6.54E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 5.46E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 4.20E-08 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 5.89E-08 mr1725 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 2.26E-13 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 1.12E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 7.02E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 1.05E-06 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 1.39E-06 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 2.13E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 4.40E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 1.25E-19 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 3.31E-15 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 7.37E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 4.02E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 3.83E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 2.07E-17 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 3.48E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 7.05E-08 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 1.34E-16 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216993343 NA 1.26E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251