\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216728542:

Variant ID: vg1216728542 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16728542
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGAACCGAAGTTAGCGAGTCTGTCGGCTGCTTCGTTATTGTGCCGAAGGACGTGGGTTAGTTCGAGCCCATCAAACTTGTCTTCCAACTTGCATACCTC[T/C]
TGCCGATAGGCGGTCATGTTGTCATCAAGGCAGGACCACTCTTTCATAACTTGATTAACAACCAACTGTGAATCTCCGCGAACTATCAAACGCCTAATTC

Reverse complement sequence

GAATTAGGCGTTTGATAGTTCGCGGAGATTCACAGTTGGTTGTTAATCAAGTTATGAAAGAGTGGTCCTGCCTTGATGACAACATGACCGCCTATCGGCA[A/G]
GAGGTATGCAAGTTGGAAGACAAGTTTGATGGGCTCGAACTAACCCACGTCCTTCGGCACAATAACGAAGCAGCCGACAGACTCGCTAACTTCGGTTCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.60% 0.20% 2.45% 15.72% NA
All Indica  2759 76.30% 0.30% 2.46% 20.99% NA
All Japonica  1512 95.10% 0.00% 2.38% 2.51% NA
Aus  269 64.30% 0.40% 2.23% 33.09% NA
Indica I  595 59.20% 0.20% 5.38% 35.29% NA
Indica II  465 71.80% 0.00% 2.58% 25.59% NA
Indica III  913 91.80% 0.50% 1.31% 6.35% NA
Indica Intermediate  786 73.80% 0.30% 1.53% 24.43% NA
Temperate Japonica  767 94.70% 0.00% 3.39% 1.96% NA
Tropical Japonica  504 96.00% 0.00% 0.99% 2.98% NA
Japonica Intermediate  241 94.60% 0.00% 2.07% 3.32% NA
VI/Aromatic  96 66.70% 0.00% 5.21% 28.12% NA
Intermediate  90 86.70% 1.10% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216728542 T -> C LOC_Os12g28290.1 synonymous_variant ; p.Gln1238Gln; LOW synonymous_codon Average:9.109; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1216728542 T -> DEL LOC_Os12g28290.1 N frameshift_variant Average:9.109; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216728542 NA 1.13E-09 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 5.24E-07 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 1.88E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 3.63E-06 NA mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 1.39E-07 1.66E-19 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 3.69E-13 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 2.53E-07 3.33E-10 mr1914 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 7.01E-07 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 2.02E-07 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 1.10E-08 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 1.69E-08 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 1.55E-12 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 1.70E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 7.94E-06 NA mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 1.16E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 2.88E-08 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 3.94E-10 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 4.34E-07 1.96E-14 mr1317_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 1.37E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 2.07E-07 mr1577_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 4.98E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 4.45E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 1.02E-10 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 8.38E-07 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 8.70E-07 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 2.86E-06 NA mr1818_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 2.51E-07 2.88E-11 mr1818_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 3.01E-19 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 6.87E-07 1.08E-11 mr1897_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 NA 4.77E-13 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 6.12E-06 4.54E-16 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 5.85E-07 NA mr1927_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216728542 1.09E-06 2.90E-15 mr1927_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251