\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216492299:

Variant ID: vg1216492299 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16492299
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGCTCTTAGGGGCTAGAACGACGTTTTTTTCCTATACGGAGGGAGTATATGTATGGGGTATGACCCGCACTCTGGCCATTTTATCAAAGACCCTCACT[A/G]
GCTTTCATGGCAATAGACAGCCACTAAAAATTAATGTTCTTATCGCATACAATGCTGAATAAAGGACGATATAGTATGATCTCGTTGCATGAGTAATAAT

Reverse complement sequence

ATTATTACTCATGCAACGAGATCATACTATATCGTCCTTTATTCAGCATTGTATGCGATAAGAACATTAATTTTTAGTGGCTGTCTATTGCCATGAAAGC[T/C]
AGTGAGGGTCTTTGATAAAATGGCCAGAGTGCGGGTCATACCCCATACATATACTCCCTCCGTATAGGAAAAAAACGTCGTTCTAGCCCCTAAGAGCATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 25.80% 4.30% 5.88% NA
All Indica  2759 53.90% 35.30% 3.77% 7.00% NA
All Japonica  1512 85.10% 4.00% 6.15% 4.76% NA
Aus  269 60.60% 36.80% 1.12% 1.49% NA
Indica I  595 66.20% 20.70% 8.74% 4.37% NA
Indica II  465 82.40% 12.70% 2.58% 2.37% NA
Indica III  913 23.90% 60.90% 1.86% 13.36% NA
Indica Intermediate  786 62.60% 30.20% 2.93% 4.33% NA
Temperate Japonica  767 90.20% 0.70% 6.91% 2.22% NA
Tropical Japonica  504 79.40% 8.50% 3.77% 8.33% NA
Japonica Intermediate  241 80.50% 5.40% 8.71% 5.39% NA
VI/Aromatic  96 28.10% 68.80% 0.00% 3.12% NA
Intermediate  90 71.10% 18.90% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216492299 A -> DEL N N silent_mutation Average:63.306; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg1216492299 A -> G LOC_Os12g27980.1 downstream_gene_variant ; 3038.0bp to feature; MODIFIER silent_mutation Average:63.306; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg1216492299 A -> G LOC_Os12g27960-LOC_Os12g27980 intergenic_region ; MODIFIER silent_mutation Average:63.306; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216492299 NA 7.59E-08 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 1.97E-07 NA mr1023 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 2.54E-06 NA mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 4.01E-06 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 8.40E-08 NA mr1079 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 5.32E-06 NA mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 1.34E-07 NA mr1142 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 8.64E-07 NA mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 8.63E-06 NA mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 9.16E-06 NA mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 5.71E-07 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 6.38E-06 NA mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 2.51E-06 NA mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 1.04E-08 NA mr1491 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 2.54E-07 1.48E-14 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 2.53E-07 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 8.35E-06 NA mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 NA 9.30E-09 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 7.99E-07 NA mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 NA 1.09E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 2.71E-09 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 1.32E-06 1.85E-16 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 2.13E-09 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 1.71E-06 8.17E-15 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 NA 2.10E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 3.04E-10 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 1.75E-06 5.23E-16 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 1.12E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 NA 2.29E-07 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 3.02E-08 NA mr1778_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216492299 NA 5.70E-14 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251