\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216345874:

Variant ID: vg1216345874 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 16345874
Reference Allele: TAlternative Allele: C,TA
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.07, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAATCTCAGAGTCTATTTTTTTATCCAACAATAGTTTCCAGGTTTCCACTACATGTATACATACGTAGTTTCCACCGTATATTTTCCCCTCTTTATCT[T/C,TA]
TTTATCCCACAAAATAGCATGACCTTTTTTTTAAACATTACTTACGTTTGGGCAATCTCACAACAAACTTTCAACTTAAAAGACAATGCAGAGCCAAAAC

Reverse complement sequence

GTTTTGGCTCTGCATTGTCTTTTAAGTTGAAAGTTTGTTGTGAGATTGCCCAAACGTAAGTAATGTTTAAAAAAAAGGTCATGCTATTTTGTGGGATAAA[A/G,TA]
AGATAAAGAGGGGAAAATATACGGTGGAAACTACGTATGTATACATGTAGTGGAAACCTGGAAACTATTGTTGGATAAAAAAATAGACTCTGAGATTTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.80% 15.20% 0.70% 34.32% TA: 0.02%
All Indica  2759 47.60% 7.70% 0.43% 44.18% TA: 0.04%
All Japonica  1512 61.60% 17.40% 1.12% 19.91% NA
Aus  269 8.90% 79.90% 0.37% 10.78% NA
Indica I  595 32.10% 0.30% 0.17% 67.39% NA
Indica II  465 50.30% 17.60% 0.65% 31.40% NA
Indica III  913 56.30% 6.80% 0.11% 36.80% NA
Indica Intermediate  786 47.70% 8.50% 0.89% 42.75% TA: 0.13%
Temperate Japonica  767 90.50% 3.40% 0.65% 5.48% NA
Tropical Japonica  504 14.70% 38.70% 2.38% 44.25% NA
Japonica Intermediate  241 67.60% 17.40% 0.00% 14.94% NA
VI/Aromatic  96 36.50% 12.50% 2.08% 48.96% NA
Intermediate  90 54.40% 15.60% 1.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216345874 T -> C LOC_Os12g27710.1 upstream_gene_variant ; 3049.0bp to feature; MODIFIER silent_mutation Average:32.141; most accessible tissue: Minghui63 flag leaf, score: 48.324 N N N N
vg1216345874 T -> C LOC_Os12g27720.1 downstream_gene_variant ; 2709.0bp to feature; MODIFIER silent_mutation Average:32.141; most accessible tissue: Minghui63 flag leaf, score: 48.324 N N N N
vg1216345874 T -> C LOC_Os12g27710-LOC_Os12g27720 intergenic_region ; MODIFIER silent_mutation Average:32.141; most accessible tissue: Minghui63 flag leaf, score: 48.324 N N N N
vg1216345874 T -> DEL N N silent_mutation Average:32.141; most accessible tissue: Minghui63 flag leaf, score: 48.324 N N N N
vg1216345874 T -> TA LOC_Os12g27710.1 upstream_gene_variant ; 3050.0bp to feature; MODIFIER silent_mutation Average:32.141; most accessible tissue: Minghui63 flag leaf, score: 48.324 N N N N
vg1216345874 T -> TA LOC_Os12g27720.1 downstream_gene_variant ; 2708.0bp to feature; MODIFIER silent_mutation Average:32.141; most accessible tissue: Minghui63 flag leaf, score: 48.324 N N N N
vg1216345874 T -> TA LOC_Os12g27710-LOC_Os12g27720 intergenic_region ; MODIFIER silent_mutation Average:32.141; most accessible tissue: Minghui63 flag leaf, score: 48.324 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216345874 3.27E-07 NA mr1016 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 3.27E-10 8.81E-21 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 1.15E-07 NA mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 8.38E-09 1.36E-19 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 1.14E-09 NA mr1018 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 7.75E-11 3.27E-21 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 4.84E-07 NA mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 4.20E-08 3.37E-15 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 NA 4.19E-08 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 3.72E-09 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 4.25E-12 3.76E-23 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 5.56E-06 NA mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 3.47E-06 2.10E-15 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 1.46E-07 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 2.23E-09 5.54E-21 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 5.92E-07 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 1.07E-06 3.87E-15 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 NA 5.18E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 NA 3.84E-14 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 NA 6.66E-06 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 1.64E-09 1.75E-21 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 1.25E-07 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 6.56E-07 3.93E-16 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 7.87E-10 3.92E-22 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 2.04E-08 NA mr1491 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 2.22E-07 2.18E-16 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 3.69E-06 4.56E-14 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 NA 3.13E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 1.78E-07 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 7.68E-09 4.97E-17 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 NA 5.22E-13 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 3.28E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 1.89E-08 5.56E-19 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 9.58E-08 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 6.15E-14 7.78E-26 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 5.31E-08 2.48E-19 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 5.02E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 7.41E-13 2.80E-27 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 2.43E-07 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 3.74E-14 2.97E-28 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 4.30E-08 2.82E-14 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 2.55E-07 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 7.45E-18 6.23E-33 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 2.55E-07 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 1.30E-08 3.63E-20 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 5.59E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 1.81E-17 4.93E-32 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 NA 3.72E-06 mr1711_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874 1.10E-06 1.01E-15 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251