Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216345874:

Variant ID: vg1216345874 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 16345874
Reference Allele: T	Alternative Allele: C,TA
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.07, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

ACAAATCTCAGAGTCTATTTTTTTATCCAACAATAGTTTCCAGGTTTCCACTACATGTATACATACGTAGTTTCCACCGTATATTTTCCCCTCTTTATCT[T/C,TA]
TTTATCCCACAAAATAGCATGACCTTTTTTTTAAACATTACTTACGTTTGGGCAATCTCACAACAAACTTTCAACTTAAAAGACAATGCAGAGCCAAAAC

Reverse complement sequence

GTTTTGGCTCTGCATTGTCTTTTAAGTTGAAAGTTTGTTGTGAGATTGCCCAAACGTAAGTAATGTTTAAAAAAAAGGTCATGCTATTTTGTGGGATAAA[A/G,TA]
AGATAAAGAGGGGAAAATATACGGTGGAAACTACGTATGTATACATGTAGTGGAAACCTGGAAACTATTGTTGGATAAAAAAATAGACTCTGAGATTTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.80%	15.20%	0.70%	34.32%	TA: 0.02%
All Indica	2759	47.60%	7.70%	0.43%	44.18%	TA: 0.04%
All Japonica	1512	61.60%	17.40%	1.12%	19.91%	NA
Aus	269	8.90%	79.90%	0.37%	10.78%	NA
Indica I	595	32.10%	0.30%	0.17%	67.39%	NA
Indica II	465	50.30%	17.60%	0.65%	31.40%	NA
Indica III	913	56.30%	6.80%	0.11%	36.80%	NA
Indica Intermediate	786	47.70%	8.50%	0.89%	42.75%	TA: 0.13%
Temperate Japonica	767	90.50%	3.40%	0.65%	5.48%	NA
Tropical Japonica	504	14.70%	38.70%	2.38%	44.25%	NA
Japonica Intermediate	241	67.60%	17.40%	0.00%	14.94%	NA
VI/Aromatic	96	36.50%	12.50%	2.08%	48.96%	NA
Intermediate	90	54.40%	15.60%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216345874	T -> C	LOC_Os12g27710.1	upstream_gene_variant ; 3049.0bp to feature; MODIFIER	silent_mutation	Average:32.141; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N
vg1216345874	T -> C	LOC_Os12g27720.1	downstream_gene_variant ; 2709.0bp to feature; MODIFIER	silent_mutation	Average:32.141; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N
vg1216345874	T -> C	LOC_Os12g27710-LOC_Os12g27720	intergenic_region ; MODIFIER	silent_mutation	Average:32.141; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N
vg1216345874	T -> DEL	N	N	silent_mutation	Average:32.141; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N
vg1216345874	T -> TA	LOC_Os12g27710.1	upstream_gene_variant ; 3050.0bp to feature; MODIFIER	silent_mutation	Average:32.141; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N
vg1216345874	T -> TA	LOC_Os12g27720.1	downstream_gene_variant ; 2708.0bp to feature; MODIFIER	silent_mutation	Average:32.141; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N
vg1216345874	T -> TA	LOC_Os12g27710-LOC_Os12g27720	intergenic_region ; MODIFIER	silent_mutation	Average:32.141; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216345874	3.27E-07	NA	mr1016	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	3.27E-10	8.81E-21	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	1.15E-07	NA	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	8.38E-09	1.36E-19	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	1.14E-09	NA	mr1018	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	7.75E-11	3.27E-21	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	4.84E-07	NA	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	4.20E-08	3.37E-15	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	NA	4.19E-08	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	3.72E-09	NA	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	4.25E-12	3.76E-23	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	5.56E-06	NA	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	3.47E-06	2.10E-15	mr1079	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	1.46E-07	NA	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	2.23E-09	5.54E-21	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	5.92E-07	NA	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	1.07E-06	3.87E-15	mr1142	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	NA	5.18E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	NA	3.84E-14	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	NA	6.66E-06	mr1188	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	1.64E-09	1.75E-21	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	1.25E-07	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	6.56E-07	3.93E-16	mr1489	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	7.87E-10	3.92E-22	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	2.04E-08	NA	mr1491	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	2.22E-07	2.18E-16	mr1491	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	3.69E-06	4.56E-14	mr1778	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	NA	3.13E-06	mr1790	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	1.78E-07	NA	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	7.68E-09	4.97E-17	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	NA	5.22E-13	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	3.28E-06	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	1.89E-08	5.56E-19	mr1023_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	9.58E-08	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	6.15E-14	7.78E-26	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	5.31E-08	2.48E-19	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	5.02E-06	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	7.41E-13	2.80E-27	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	2.43E-07	NA	mr1178_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	3.74E-14	2.97E-28	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	4.30E-08	2.82E-14	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	2.55E-07	NA	mr1390_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	7.45E-18	6.23E-33	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	2.55E-07	NA	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	1.30E-08	3.63E-20	mr1489_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	5.59E-06	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	1.81E-17	4.93E-32	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	NA	3.72E-06	mr1711_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216345874	1.10E-06	1.01E-15	mr1778_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251