\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216309552:

Variant ID: vg1216309552 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 16309552
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTCCTCTGGCTGACGCATCCAGGCAAGGGTGCGCGTGATGGAGCGGGATGGGCTCTGCGACGGCCTTTGTCGCTTCCGGATTCACCTAGGCACGAGAG[G/A]
GGACTGCCCACTGCCTGTTGAGGAGTGGGGGGTGAAACCTGAGGTGTGGTGTGCTTGGTCAGAGGGGGTTATATGAAGGGTCTTGTCACAATCACTCAGC

Reverse complement sequence

GCTGAGTGATTGTGACAAGACCCTTCATATAACCCCCTCTGACCAAGCACACCACACCTCAGGTTTCACCCCCCACTCCTCAACAGGCAGTGGGCAGTCC[C/T]
CTCTCGTGCCTAGGTGAATCCGGAAGCGACAAAGGCCGTCGCAGAGCCCATCCCGCTCCATCACGCGCACCCTTGCCTGGATGCGTCAGCCAGAGGAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.00% 11.10% 2.67% 29.24% NA
All Indica  2759 54.70% 2.80% 3.59% 38.89% NA
All Japonica  1512 65.30% 17.40% 0.86% 16.47% NA
Aus  269 20.40% 62.50% 2.60% 14.50% NA
Indica I  595 80.50% 0.20% 1.68% 17.65% NA
Indica II  465 49.00% 9.70% 3.66% 37.63% NA
Indica III  913 37.10% 0.80% 4.38% 57.72% NA
Indica Intermediate  786 58.90% 3.20% 4.07% 33.84% NA
Temperate Japonica  767 96.00% 0.30% 0.00% 3.78% NA
Tropical Japonica  504 13.50% 48.40% 2.38% 35.71% NA
Japonica Intermediate  241 75.90% 7.10% 0.41% 16.60% NA
VI/Aromatic  96 86.50% 1.00% 2.08% 10.42% NA
Intermediate  90 65.60% 16.70% 5.56% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1216309552 G -> DEL N N silent_mutation Average:61.578; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1216309552 G -> A LOC_Os12g27670.1 upstream_gene_variant ; 4673.0bp to feature; MODIFIER silent_mutation Average:61.578; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1216309552 G -> A LOC_Os12g27680.1 upstream_gene_variant ; 269.0bp to feature; MODIFIER silent_mutation Average:61.578; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1216309552 G -> A LOC_Os12g27680-LOC_Os12g27690 intergenic_region ; MODIFIER silent_mutation Average:61.578; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1216309552 NA 1.03E-08 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 3.07E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 3.91E-09 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 7.66E-11 mr1382 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 3.03E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 8.36E-08 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 8.51E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 9.43E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 2.35E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 4.64E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 2.31E-16 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 4.87E-09 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 5.30E-07 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 3.82E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 5.33E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 7.10E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 2.19E-07 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 3.80E-06 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 7.87E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 1.91E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 4.61E-07 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 7.15E-07 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 2.55E-06 NA mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 1.06E-07 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 7.91E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 5.79E-06 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 5.66E-09 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 3.60E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 7.23E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216309552 NA 1.81E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251