Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1216176025:

Variant ID: vg1216176025 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 16176025
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

AAATTTACACAAAAATGTAAATTTACACATCGTTAAGTTATCCATGACACATCTCGTACGTTACAGATAAAATAGAAGCACAAATCATGAACTTACCTTG[C/T]
GGCATCTGTACATTGAAGGAGAGGGAGTATTGTGCCACATGCGCCACCACATCTGCACTAGGAAGAGAGAGATCCACTTGACCCATACGTGCACAACACC

Reverse complement sequence

GGTGTTGTGCACGTATGGGTCAAGTGGATCTCTCTCTTCCTAGTGCAGATGTGGTGGCGCATGTGGCACAATACTCCCTCTCCTTCAATGTACAGATGCC[G/A]
CAAGGTAAGTTCATGATTTGTGCTTCTATTTTATCTGTAACGTACGAGATGTGTCATGGATAACTTAACGATGTGTAAATTTACATTTTTGTGTAAATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	16.10%	1.40%	19.81%	NA
All Indica	2759	46.00%	19.00%	1.88%	33.09%	NA
All Japonica	1512	83.30%	15.00%	0.93%	0.73%	NA
Aus	269	99.30%	0.40%	0.00%	0.37%	NA
Indica I	595	21.70%	2.40%	1.68%	74.29%	NA
Indica II	465	40.00%	47.30%	3.01%	9.68%	NA
Indica III	913	64.80%	12.50%	1.20%	21.47%	NA
Indica Intermediate	786	46.10%	22.50%	2.16%	29.26%	NA
Temperate Japonica	767	97.90%	1.40%	0.26%	0.39%	NA
Tropical Japonica	504	58.50%	38.90%	1.59%	0.99%	NA
Japonica Intermediate	241	88.80%	8.30%	1.66%	1.24%	NA
VI/Aromatic	96	94.80%	4.20%	0.00%	1.04%	NA
Intermediate	90	83.30%	5.60%	0.00%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1216176025	C -> DEL	N	N	silent_mutation	Average:44.674; most accessible tissue: Minghui63 flag leaf, score: 87.052	N	N	N	N
vg1216176025	C -> T	LOC_Os12g27480-LOC_Os12g27490	intergenic_region ; MODIFIER	silent_mutation	Average:44.674; most accessible tissue: Minghui63 flag leaf, score: 87.052	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1216176025	1.94E-10	3.74E-14	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	6.32E-11	1.46E-13	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	2.81E-08	4.92E-11	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	8.46E-08	3.79E-11	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	9.43E-07	NA	mr1023	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	NA	3.56E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	1.36E-10	5.11E-13	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	1.96E-09	1.76E-12	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	2.35E-06	NA	mr1142	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	5.58E-06	NA	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	3.40E-06	4.28E-10	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	1.13E-08	7.78E-11	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	NA	6.33E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	8.37E-09	NA	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	8.46E-06	NA	mr1491	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	NA	9.49E-07	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	NA	6.88E-09	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	5.95E-06	5.95E-06	mr1898	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	1.57E-06	NA	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	1.74E-07	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	6.67E-10	8.75E-12	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	3.48E-07	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	3.22E-11	5.32E-14	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	3.70E-08	NA	mr1178_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	4.46E-09	5.47E-13	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	8.72E-06	5.38E-08	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	7.09E-09	NA	mr1390_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	6.76E-10	NA	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	9.23E-07	NA	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1216176025	1.03E-11	NA	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251