\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215962650:

Variant ID: vg1215962650 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15962650
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


AACACGCTGCTTCGCTATGTTTCCATTTTCACCAGATTGAGCCAAGAATTGGCATGTGTACAGACCAATGTGCCCCTGTCTCATTCTTTAGGTTTGTGAG[C/T]
GAAAGGGGATCGATATTATTTGCTGACTGCTTTGATTTGTCGGCGCACCTGAGGGGGCTCTCCGTTGGCGCCGCGATGGCGACACTGCACGTCTGGATCA

Reverse complement sequence

TGATCCAGACGTGCAGTGTCGCCATCGCGGCGCCAACGGAGAGCCCCCTCAGGTGCGCCGACAAATCAAAGCAGTCAGCAAATAATATCGATCCCCTTTC[G/A]
CTCACAAACCTAAAGAATGAGACAGGGGCACATTGGTCTGTACACATGCCAATTCTTGGCTCAATCTGGTGAAAATGGAAACATAGCGAAGCAGCGTGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.10% 24.30% 0.21% 5.42% NA
All Indica  2759 59.10% 40.60% 0.07% 0.22% NA
All Japonica  1512 85.90% 0.70% 0.40% 12.96% NA
Aus  269 98.10% 1.10% 0.00% 0.74% NA
Indica I  595 83.20% 16.80% 0.00% 0.00% NA
Indica II  465 51.00% 48.60% 0.22% 0.22% NA
Indica III  913 45.00% 54.70% 0.00% 0.33% NA
Indica Intermediate  786 62.10% 37.50% 0.13% 0.25% NA
Temperate Japonica  767 98.00% 0.80% 0.00% 1.17% NA
Tropical Japonica  504 66.70% 0.60% 0.99% 31.75% NA
Japonica Intermediate  241 87.60% 0.80% 0.41% 11.20% NA
VI/Aromatic  96 45.80% 2.10% 2.08% 50.00% NA
Intermediate  90 83.30% 12.20% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215962650 C -> DEL N N silent_mutation Average:51.585; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg1215962650 C -> T LOC_Os12g27200.1 upstream_gene_variant ; 76.0bp to feature; MODIFIER silent_mutation Average:51.585; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg1215962650 C -> T LOC_Os12g27210.1 upstream_gene_variant ; 3313.0bp to feature; MODIFIER silent_mutation Average:51.585; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg1215962650 C -> T LOC_Os12g27190.1 downstream_gene_variant ; 738.0bp to feature; MODIFIER silent_mutation Average:51.585; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg1215962650 C -> T LOC_Os12g27190-LOC_Os12g27200 intergenic_region ; MODIFIER silent_mutation Average:51.585; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215962650 4.93E-07 NA mr1016 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 NA 1.00E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 3.09E-07 NA mr1017 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 3.19E-06 1.06E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 8.40E-06 1.23E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 NA 2.26E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 4.66E-06 NA mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 8.28E-08 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 6.02E-06 NA mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 3.54E-08 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 NA 1.01E-10 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 1.67E-07 NA mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 3.78E-09 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 1.68E-07 2.63E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 8.31E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 2.16E-06 NA mr1178 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 1.85E-08 NA mr1390 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 NA 2.38E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 2.87E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 1.02E-07 NA mr1490 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 NA 3.37E-11 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 7.63E-07 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 6.36E-06 NA mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 3.00E-10 NA mr1055_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 1.33E-07 6.27E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 5.83E-08 NA mr1079_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 3.73E-13 NA mr1132_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 2.08E-09 4.39E-14 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 1.72E-08 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 1.25E-06 NA mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 NA 3.10E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 3.33E-11 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 1.10E-07 3.75E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 1.17E-08 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 7.89E-06 NA mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 1.35E-08 NA mr1490_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215962650 1.66E-08 6.32E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251