\
| Variant ID: vg1214134657 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14134657 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACCGCGATGAGAAACAGATATTGTACGATACAATCGCGGAGGGAAGCAGCCAGTACTGGAATGAAGAAGAGGGAACGAGGATCCAAACCAGTACTTGAAC[G/A]
AGGAAGGGAACGTGGAGAGGGATGCGGAGGGAAACCAGTAGGGGCACGTGGAAAGGGATGTGGAGGGGAACCAGGAGGAGGAGGCTAGTGGTAGTCAACC
GGTTGACTACCACTAGCCTCCTCCTCCTGGTTCCCCTCCACATCCCTTTCCACGTGCCCCTACTGGTTTCCCTCCGCATCCCTCTCCACGTTCCCTTCCT[C/T]
GTTCAAGTACTGGTTTGGATCCTCGTTCCCTCTTCTTCATTCCAGTACTGGCTGCTTCCCTCCGCGATTGTATCGTACAATATCTGTTTCTCATCGCGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.10% | 0.10% | 14.33% | 64.49% | NA |
| All Indica | 2759 | 8.50% | 0.10% | 18.92% | 72.49% | NA |
| All Japonica | 1512 | 47.80% | 0.00% | 1.79% | 50.40% | NA |
| Aus | 269 | 1.90% | 1.50% | 37.17% | 59.48% | NA |
| Indica I | 595 | 5.00% | 0.20% | 15.97% | 78.82% | NA |
| Indica II | 465 | 14.20% | 0.00% | 14.41% | 71.40% | NA |
| Indica III | 913 | 6.20% | 0.00% | 24.32% | 69.44% | NA |
| Indica Intermediate | 786 | 10.40% | 0.10% | 17.56% | 71.88% | NA |
| Temperate Japonica | 767 | 77.40% | 0.00% | 1.56% | 20.99% | NA |
| Tropical Japonica | 504 | 13.50% | 0.00% | 2.18% | 84.33% | NA |
| Japonica Intermediate | 241 | 25.30% | 0.00% | 1.66% | 73.03% | NA |
| VI/Aromatic | 96 | 3.10% | 0.00% | 14.58% | 82.29% | NA |
| Intermediate | 90 | 32.20% | 0.00% | 15.56% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214134657 | G -> DEL | N | N | silent_mutation | Average:5.671; most accessible tissue: Minghui63 flower, score: 9.27 | N | N | N | N |
| vg1214134657 | G -> A | LOC_Os12g24680.1 | intron_variant ; MODIFIER | silent_mutation | Average:5.671; most accessible tissue: Minghui63 flower, score: 9.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214134657 | 6.14E-06 | 6.15E-06 | mr1054_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 9.68E-06 | 9.66E-06 | mr1061_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 2.06E-06 | NA | mr1151_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 2.17E-06 | mr1204_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 2.53E-06 | mr1230_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 4.30E-06 | 2.83E-09 | mr1236_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 1.81E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 1.02E-09 | 1.62E-11 | mr1263_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 4.65E-06 | NA | mr1275_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 3.29E-06 | NA | mr1283_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 6.50E-06 | 6.51E-06 | mr1285_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 5.89E-07 | NA | mr1298_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 8.74E-06 | NA | mr1304_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 2.90E-06 | mr1306_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 3.09E-06 | 8.22E-07 | mr1318_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 3.73E-06 | 3.73E-06 | mr1356_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 1.42E-06 | 1.42E-06 | mr1372_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 7.46E-07 | mr1406_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 4.33E-06 | 4.32E-06 | mr1412_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 1.46E-06 | mr1421_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 5.70E-06 | 5.70E-06 | mr1447_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 2.07E-06 | mr1456_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 8.95E-06 | 8.95E-06 | mr1459_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 1.70E-06 | 1.70E-06 | mr1463_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 2.24E-06 | 2.24E-06 | mr1485_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 3.52E-06 | NA | mr1488_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 1.02E-06 | 1.02E-06 | mr1501_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 8.42E-06 | NA | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 4.17E-06 | NA | mr1556_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 1.46E-06 | mr1562_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 5.50E-06 | NA | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 1.27E-06 | mr1597_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 1.38E-06 | 1.38E-06 | mr1605_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 6.56E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 3.17E-06 | mr1638_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 3.44E-06 | NA | mr1681_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 6.50E-06 | NA | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 2.61E-07 | 1.37E-10 | mr1729_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 5.74E-07 | NA | mr1731_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 8.66E-06 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 9.04E-09 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 1.54E-09 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 3.88E-06 | 3.87E-06 | mr1752_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 2.39E-06 | 2.39E-06 | mr1753_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 3.26E-06 | 3.44E-06 | mr1759_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 5.82E-06 | NA | mr1764_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 1.04E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 3.26E-06 | mr1823_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | NA | 2.65E-06 | mr1876_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 5.97E-07 | 5.96E-07 | mr1953_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 2.25E-06 | 1.65E-06 | mr1960_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214134657 | 9.19E-06 | 9.20E-06 | mr1985_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |