Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1213915685:

Variant ID: vg1213915685 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 13915685
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, A: 0.09, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGGTGCCCAGCGCTGACGAGGATGTCAAGCAGGAGATGGCTGCCAACCCACTCGCCGCTATCTCCGCCCCGCTCGGCTTCTACCTGGAGAACGCCATC[C/A]
AGGCACTGCAGGCCATCCAGAAGATCATCGCCGCCAACACAATTTGATATTATATATTGCCTTGCCCGTCCAATTCGAATTTACTATCCCAGTCCCAGAC

Reverse complement sequence

GTCTGGGACTGGGATAGTAAATTCGAATTGGACGGGCAAGGCAATATATAATATCAAATTGTGTTGGCGGCGATGATCTTCTGGATGGCCTGCAGTGCCT[G/T]
GATGGCGTTCTCCAGGTAGAAGCCGAGCGGGGCGGAGATAGCGGCGAGTGGGTTGGCAGCCATCTCCTGCTTGACATCCTCGTCAGCGCTGGGCACCGGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.60% 47.10% 0.28% 0.00% NA
All Indica  2759 69.80% 29.90% 0.36% 0.00% NA
All Japonica  1512 14.70% 85.30% 0.00% 0.00% NA
Aus  269 84.00% 15.60% 0.37% 0.00% NA
Indica I  595 92.30% 6.60% 1.18% 0.00% NA
Indica II  465 32.50% 67.50% 0.00% 0.00% NA
Indica III  913 75.40% 24.50% 0.11% 0.00% NA
Indica Intermediate  786 68.30% 31.40% 0.25% 0.00% NA
Temperate Japonica  767 5.60% 94.40% 0.00% 0.00% NA
Tropical Japonica  504 17.50% 82.50% 0.00% 0.00% NA
Japonica Intermediate  241 37.80% 62.20% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 42.20% 55.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1213915685 C -> A LOC_Os12g24390.1 missense_variant ; p.Gln510Lys; MODERATE nonsynonymous_codon ; Q510K Average:76.989; most accessible tissue: Zhenshan97 root, score: 91.642 benign -0.209 TOLERATED 0.18

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1213915685 C A -0.12 -0.04 -0.03 -0.03 -0.04 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1213915685 NA 1.60E-14 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1213915685 NA 1.99E-06 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213915685 NA 6.44E-06 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213915685 NA 7.42E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213915685 NA 1.33E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213915685 NA 6.03E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213915685 NA 3.95E-07 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213915685 NA 4.99E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1213915685 NA 3.82E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251