\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1212132495:

Variant ID: vg1212132495 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 12132495
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AACCAAATGAATAGTACAATTAAAGTTCATAAATGGGTAGATCTTGTATTTAGATGAATTATGAGACTTGAACGACCTCATTCCGAGTTCGAACGAATTA[T/G]
TTATGAATTTTACAAGAATTAATTTCAATTAAACCTATTAAAGAAAGAACTATTCCAAATTGTTTAAACAATTTACAAATGATTTATAGCTGAGACAAAA

Reverse complement sequence

TTTTGTCTCAGCTATAAATCATTTGTAAATTGTTTAAACAATTTGGAATAGTTCTTTCTTTAATAGGTTTAATTGAAATTAATTCTTGTAAAATTCATAA[A/C]
TAATTCGTTCGAACTCGGAATGAGGTCGTTCAAGTCTCATAATTCATCTAAATACAAGATCTACCCATTTATGAACTTTAATTGTACTATTCATTTGGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 0.60% 6.52% 2.16% NA
All Indica  2759 84.40% 0.90% 11.09% 3.59% NA
All Japonica  1512 99.80% 0.00% 0.00% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 0.20% 0.67% 0.34% NA
Indica II  465 76.10% 0.60% 14.62% 8.60% NA
Indica III  913 80.10% 1.20% 15.99% 2.74% NA
Indica Intermediate  786 83.30% 1.40% 11.20% 4.07% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1212132495 T -> DEL N N silent_mutation Average:46.054; most accessible tissue: Minghui63 flag leaf, score: 63.086 N N N N
vg1212132495 T -> G LOC_Os12g21590.1 upstream_gene_variant ; 580.0bp to feature; MODIFIER silent_mutation Average:46.054; most accessible tissue: Minghui63 flag leaf, score: 63.086 N N N N
vg1212132495 T -> G LOC_Os12g21570.1 downstream_gene_variant ; 3782.0bp to feature; MODIFIER silent_mutation Average:46.054; most accessible tissue: Minghui63 flag leaf, score: 63.086 N N N N
vg1212132495 T -> G LOC_Os12g21580.1 downstream_gene_variant ; 1523.0bp to feature; MODIFIER silent_mutation Average:46.054; most accessible tissue: Minghui63 flag leaf, score: 63.086 N N N N
vg1212132495 T -> G LOC_Os12g21580-LOC_Os12g21590 intergenic_region ; MODIFIER silent_mutation Average:46.054; most accessible tissue: Minghui63 flag leaf, score: 63.086 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1212132495 6.69E-06 9.89E-08 mr1157 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212132495 NA 5.70E-07 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212132495 NA 1.43E-06 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1212132495 NA 3.68E-07 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251