\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1211776048:

Variant ID: vg1211776048 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 11776048
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCATCCATGTCGAAAATTCACCCCGTGTCTCACGCGGCGAGCTTTTATCCATTGATGCCAATGTTGGCCAATATTGGCCCACGTGGGTGCGATGTTTTT[T/C]
ACCCGAATGAAAGAGTTCACAAGCATGAAAAAATGATTTTTGGATATATTGGAGTGTATTGGGTGCGTCCGTGTGGAAAAAATCACTCCGTGACTCGCGC

Reverse complement sequence

GCGCGAGTCACGGAGTGATTTTTTCCACACGGACGCACCCAATACACTCCAATATATCCAAAAATCATTTTTTCATGCTTGTGAACTCTTTCATTCGGGT[A/G]
AAAAACATCGCACCCACGTGGGCCAATATTGGCCAACATTGGCATCAATGGATAAAAGCTCGCCGCGTGAGACACGGGGTGAATTTTCGACATGGATGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 15.20% 0.28% 11.13% NA
All Indica  2759 79.30% 2.00% 0.29% 18.41% NA
All Japonica  1512 56.20% 42.50% 0.33% 1.06% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.50% 2.70% 0.00% 1.85% NA
Indica II  465 64.30% 3.70% 0.86% 31.18% NA
Indica III  913 78.50% 0.40% 0.00% 21.03% NA
Indica Intermediate  786 77.00% 2.20% 0.51% 20.36% NA
Temperate Japonica  767 21.80% 75.90% 0.52% 1.83% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 76.80% 22.00% 0.41% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 74.40% 23.30% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1211776048 T -> C LOC_Os12g20200.1 upstream_gene_variant ; 4483.0bp to feature; MODIFIER silent_mutation Average:51.572; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg1211776048 T -> C LOC_Os12g20190-LOC_Os12g20200 intergenic_region ; MODIFIER silent_mutation Average:51.572; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg1211776048 T -> DEL N N silent_mutation Average:51.572; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1211776048 NA 2.03E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 2.89E-06 4.26E-62 mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 3.11E-17 mr1023 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 5.99E-48 mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 3.99E-14 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 1.35E-60 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 2.18E-16 mr1142 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 1.16E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 5.37E-13 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 1.80E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 5.22E-07 6.20E-70 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 4.16E-16 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 4.44E-16 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 3.27E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 7.09E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 5.11E-06 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 4.61E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 5.97E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 1.52E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 4.32E-15 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 2.21E-14 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 1.64E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 2.49E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 1.96E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 1.53E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 2.98E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 4.16E-14 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 1.89E-12 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1211776048 NA 5.17E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251