Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1210574208:

Variant ID: vg1210574208 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 10574208
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGCCAATTTAATTTTAGTGTTTATTCCTAATTAATTATTCCTTATTCGCGATCGGTAAACTTTGAAACCAAATTCCAATAAAATAGGCAAATAAAATC[A/G]
GCATGATGCAATTTATTAAAAAGTTTTTGAAGGCCCATATTTTTAGAGTTTTGATTTTCGTTGGTTGAATTTTCAGGATGTTACAAACCTACCCCCCTTA

Reverse complement sequence

TAAGGGGGGTAGGTTTGTAACATCCTGAAAATTCAACCAACGAAAATCAAAACTCTAAAAATATGGGCCTTCAAAAACTTTTTAATAAATTGCATCATGC[T/C]
GATTTTATTTGCCTATTTTATTGGAATTTGGTTTCAAAGTTTACCGATCGCGAATAAGGAATAATTAATTAGGAATAAACACTAAAATTAAATTGGCAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.30%	25.30%	0.44%	0.00%	NA
All Indica	2759	95.20%	4.30%	0.43%	0.00%	NA
All Japonica	1512	31.80%	68.20%	0.00%	0.00%	NA
Aus	269	96.70%	0.40%	2.97%	0.00%	NA
Indica I	595	95.80%	3.40%	0.84%	0.00%	NA
Indica II	465	87.30%	12.70%	0.00%	0.00%	NA
Indica III	913	98.80%	0.90%	0.33%	0.00%	NA
Indica Intermediate	786	95.30%	4.20%	0.51%	0.00%	NA
Temperate Japonica	767	23.50%	76.50%	0.00%	0.00%	NA
Tropical Japonica	504	37.50%	62.50%	0.00%	0.00%	NA
Japonica Intermediate	241	46.50%	53.50%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	62.20%	36.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1210574208	A -> G	LOC_Os12g18320.1	downstream_gene_variant ; 124.0bp to feature; MODIFIER	silent_mutation	Average:29.999; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1210574208	A -> G	LOC_Os12g18330.1	downstream_gene_variant ; 4881.0bp to feature; MODIFIER	silent_mutation	Average:29.999; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1210574208	A -> G	LOC_Os12g18310-LOC_Os12g18320	intergenic_region ; MODIFIER	silent_mutation	Average:29.999; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1210574208	NA	2.68E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	1.85E-09	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	1.32E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	3.19E-07	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	4.89E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	1.68E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	1.02E-07	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	1.05E-06	mr1289	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	1.36E-08	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	7.65E-07	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	9.55E-06	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	5.83E-07	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	2.94E-08	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	4.42E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	1.54E-06	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	7.48E-06	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	9.89E-06	mr1937	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	2.31E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	2.51E-11	mr1030_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	3.19E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	1.76E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	3.73E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	1.72E-09	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	9.12E-08	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	9.54E-10	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	7.73E-07	mr1391_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	6.24E-07	mr1442_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	7.06E-07	mr1442_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	8.88E-06	1.49E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	9.88E-07	9.88E-07	mr1456_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	1.10E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	1.54E-08	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	4.47E-06	mr1566_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	1.22E-09	mr1577_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	8.60E-07	mr1577_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	1.59E-16	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	7.15E-07	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	7.95E-08	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	8.13E-07	1.74E-32	mr1780_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	8.98E-08	mr1780_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	4.84E-11	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	5.21E-07	mr1792_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	2.72E-12	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1210574208	NA	6.56E-07	mr1803_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251