\
| Variant ID: vg1209679986 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9679986 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 88. )
CAATACGTGTTAGCTGAGCTGTTATGAGAAATAATGTCTCCTCTGTCACGATTTCGTTTCCTTTCGTGATTTTTTCTCTCTAACGTGTTTTTTAACTCCT[T/C]
GGCAAAATAAACGCAAGCTAATCTTTCAGATTTTTTTCCAAAGTGGTCATAAAATCGATGACGTTCTTAAAGGCTATGATAAGATTTTTAACACGGAATG
CATTCCGTGTTAAAAATCTTATCATAGCCTTTAAGAACGTCATCGATTTTATGACCACTTTGGAAAAAAATCTGAAAGATTAGCTTGCGTTTATTTTGCC[A/G]
AGGAGTTAAAAAACACGTTAGAGAGAAAAAATCACGAAAGGAAACGAAATCGTGACAGAGGAGACATTATTTCTCATAACAGCTCAGCTAACACGTATTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.80% | 36.40% | 0.38% | 25.37% | NA |
| All Indica | 2759 | 41.00% | 19.40% | 0.51% | 39.07% | NA |
| All Japonica | 1512 | 22.30% | 74.40% | 0.00% | 3.31% | NA |
| Aus | 269 | 80.70% | 3.00% | 0.37% | 15.99% | NA |
| Indica I | 595 | 55.10% | 28.40% | 0.84% | 15.63% | NA |
| Indica II | 465 | 39.10% | 30.50% | 0.22% | 30.11% | NA |
| Indica III | 913 | 30.10% | 5.80% | 0.77% | 63.31% | NA |
| Indica Intermediate | 786 | 44.00% | 21.90% | 0.13% | 33.97% | NA |
| Temperate Japonica | 767 | 9.40% | 85.00% | 0.00% | 5.61% | NA |
| Tropical Japonica | 504 | 31.90% | 66.90% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 43.20% | 56.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 65.60% | 9.40% | 2.08% | 22.92% | NA |
| Intermediate | 90 | 44.40% | 47.80% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209679986 | T -> C | LOC_Os12g16870.1 | upstream_gene_variant ; 4371.0bp to feature; MODIFIER | silent_mutation | Average:37.649; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| vg1209679986 | T -> C | LOC_Os12g16870-LOC_Os12g16880 | intergenic_region ; MODIFIER | silent_mutation | Average:37.649; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| vg1209679986 | T -> DEL | N | N | silent_mutation | Average:37.649; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209679986 | 3.85E-06 | NA | mr1010 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209679986 | NA | 6.80E-08 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209679986 | 2.94E-07 | NA | mr1689 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209679986 | NA | 8.78E-06 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209679986 | NA | 1.55E-07 | mr1425_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209679986 | NA | 8.85E-08 | mr1425_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |