Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208517760:

Variant ID: vg1208517760 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8517760
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.41, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTGGCGAATGGGGTGCGACCCCTTCTAGACATAGAAACGCTTAAGAGAAGCAGCGTTCCAGGAGTGGTCAAACTCTTCGCCTTCCAGTGTTGCCAAAC[A/G]
AAAAGATCCCATCCTGGACCTGTGTTTGATGAGGTACAGCCCTTCCCATTTTGATTCAAGCTTTCCGACCGCCACTGGGTTCGCCTTCTTCCATAGGACG

Reverse complement sequence

CGTCCTATGGAAGAAGGCGAACCCAGTGGCGGTCGGAAAGCTTGAATCAAAATGGGAAGGGCTGTACCTCATCAAACACAGGTCCAGGATGGGATCTTTT[T/C]
GTTTGGCAACACTGGAAGGCGAAGAGTTTGACCACTCCTGGAACGCTGCTTCTCTTAAGCGTTTCTATGTCTAGAAGGGGTCGCACCCCATTCGCCAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.70%	19.40%	1.29%	52.52%	NA
All Indica	2759	13.80%	8.60%	2.03%	75.57%	NA
All Japonica	1512	55.30%	40.50%	0.13%	4.10%	NA
Aus	269	3.00%	7.10%	0.74%	89.22%	NA
Indica I	595	21.70%	13.10%	2.02%	63.19%	NA
Indica II	465	8.40%	11.80%	1.08%	78.71%	NA
Indica III	913	12.20%	2.80%	2.52%	82.48%	NA
Indica Intermediate	786	13.10%	9.80%	2.04%	75.06%	NA
Temperate Japonica	767	30.60%	64.00%	0.26%	5.08%	NA
Tropical Japonica	504	85.50%	11.10%	0.00%	3.37%	NA
Japonica Intermediate	241	70.50%	27.00%	0.00%	2.49%	NA
VI/Aromatic	96	7.30%	24.00%	0.00%	68.75%	NA
Intermediate	90	34.40%	32.20%	1.11%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208517760	A -> DEL	LOC_Os12g14890.1	N	frameshift_variant	Average:10.499; most accessible tissue: Callus, score: 48.42	N	N	N	N
vg1208517760	A -> G	LOC_Os12g14890.1	missense_variant ; p.Cys369Arg; MODERATE	nonsynonymous_codon ; C369H	Average:10.499; most accessible tissue: Callus, score: 48.42	benign	0.324	DELETERIOUS	0.05
vg1208517760	A -> G	LOC_Os12g14890.1	missense_variant ; p.Cys369Arg; MODERATE	nonsynonymous_codon ; C369R	Average:10.499; most accessible tissue: Callus, score: 48.42	benign	-0.135	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208517760	NA	3.70E-12	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208517760	NA	2.46E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208517760	5.91E-08	2.30E-12	mr1002	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	4.22E-06	2.45E-13	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	5.60E-07	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	8.14E-09	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	4.20E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	1.25E-07	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	2.60E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	2.69E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	2.87E-10	1.65E-18	mr1002_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	2.02E-10	5.32E-21	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	3.13E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	2.60E-10	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	2.60E-09	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	2.75E-11	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	3.18E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	5.36E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	6.39E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	7.89E-06	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	8.88E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	6.34E-08	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	4.33E-10	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	2.28E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760	NA	7.54E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251