\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208517760:

Variant ID: vg1208517760 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8517760
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.41, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTGGCGAATGGGGTGCGACCCCTTCTAGACATAGAAACGCTTAAGAGAAGCAGCGTTCCAGGAGTGGTCAAACTCTTCGCCTTCCAGTGTTGCCAAAC[A/G]
AAAAGATCCCATCCTGGACCTGTGTTTGATGAGGTACAGCCCTTCCCATTTTGATTCAAGCTTTCCGACCGCCACTGGGTTCGCCTTCTTCCATAGGACG

Reverse complement sequence

CGTCCTATGGAAGAAGGCGAACCCAGTGGCGGTCGGAAAGCTTGAATCAAAATGGGAAGGGCTGTACCTCATCAAACACAGGTCCAGGATGGGATCTTTT[T/C]
GTTTGGCAACACTGGAAGGCGAAGAGTTTGACCACTCCTGGAACGCTGCTTCTCTTAAGCGTTTCTATGTCTAGAAGGGGTCGCACCCCATTCGCCAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.70% 19.40% 1.29% 52.52% NA
All Indica  2759 13.80% 8.60% 2.03% 75.57% NA
All Japonica  1512 55.30% 40.50% 0.13% 4.10% NA
Aus  269 3.00% 7.10% 0.74% 89.22% NA
Indica I  595 21.70% 13.10% 2.02% 63.19% NA
Indica II  465 8.40% 11.80% 1.08% 78.71% NA
Indica III  913 12.20% 2.80% 2.52% 82.48% NA
Indica Intermediate  786 13.10% 9.80% 2.04% 75.06% NA
Temperate Japonica  767 30.60% 64.00% 0.26% 5.08% NA
Tropical Japonica  504 85.50% 11.10% 0.00% 3.37% NA
Japonica Intermediate  241 70.50% 27.00% 0.00% 2.49% NA
VI/Aromatic  96 7.30% 24.00% 0.00% 68.75% NA
Intermediate  90 34.40% 32.20% 1.11% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208517760 A -> DEL LOC_Os12g14890.1 N frameshift_variant Average:10.499; most accessible tissue: Callus, score: 48.42 N N N N
vg1208517760 A -> G LOC_Os12g14890.1 missense_variant ; p.Cys369Arg; MODERATE nonsynonymous_codon ; C369H Average:10.499; most accessible tissue: Callus, score: 48.42 benign 0.324 DELETERIOUS 0.05
vg1208517760 A -> G LOC_Os12g14890.1 missense_variant ; p.Cys369Arg; MODERATE nonsynonymous_codon ; C369R Average:10.499; most accessible tissue: Callus, score: 48.42 benign -0.135 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208517760 NA 3.70E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208517760 NA 2.46E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208517760 5.91E-08 2.30E-12 mr1002 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 4.22E-06 2.45E-13 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 5.60E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 8.14E-09 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 4.20E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 1.25E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 2.60E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 2.69E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 2.87E-10 1.65E-18 mr1002_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 2.02E-10 5.32E-21 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 3.13E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 2.60E-10 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 2.60E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 2.75E-11 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 3.18E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 5.36E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 6.39E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 7.89E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 8.88E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 6.34E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 4.33E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 2.28E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208517760 NA 7.54E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251