\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208455296:

Variant ID: vg1208455296 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8455296
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GACGGGACGATCCAGGAGAAGTTGACGGGCAGCTAACAAAGAAAAGAATTCCTGCTAAGGTGATGTGGTATTTCCCTATAATACCACGGCTAAGGCGTTT[G/A]
TTCAGGAACAAGGGAAATGCTAAAATGTTGCGATGGCACGCTGAAGAGCGTCAACAGGATGGGATGCTGAGACACCCCGCCGATGGTTCGCAGTGGCGAA

Reverse complement sequence

TTCGCCACTGCGAACCATCGGCGGGGTGTCTCAGCATCCCATCCTGTTGACGCTCTTCAGCGTGCCATCGCAACATTTTAGCATTTCCCTTGTTCCTGAA[C/T]
AAACGCCTTAGCCGTGGTATTATAGGGAAATACCACATCACCTTAGCAGGAATTCTTTTCTTTGTTAGCTGCCCGTCAACTTCTCCTGGATCGTCCCGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.60% 19.40% 1.71% 59.27% NA
All Indica  2759 7.40% 2.20% 2.72% 87.64% NA
All Japonica  1512 41.50% 53.90% 0.20% 4.43% NA
Aus  269 16.00% 1.50% 0.37% 82.16% NA
Indica I  595 13.10% 4.20% 1.51% 81.18% NA
Indica II  465 9.90% 2.40% 1.29% 86.45% NA
Indica III  913 1.30% 0.90% 3.50% 94.30% NA
Indica Intermediate  786 8.80% 2.20% 3.56% 85.50% NA
Temperate Japonica  767 66.40% 27.80% 0.13% 5.74% NA
Tropical Japonica  504 10.70% 85.30% 0.40% 3.57% NA
Japonica Intermediate  241 26.60% 71.40% 0.00% 2.07% NA
VI/Aromatic  96 24.00% 9.40% 0.00% 66.67% NA
Intermediate  90 32.20% 31.10% 2.22% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208455296 G -> DEL LOC_Os12g14780.1 N frameshift_variant Average:6.904; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N
vg1208455296 G -> A LOC_Os12g14780.1 synonymous_variant ; p.Leu179Leu; LOW synonymous_codon Average:6.904; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208455296 NA 2.44E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208455296 1.31E-09 3.65E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 2.15E-12 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 1.70E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 2.13E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 2.46E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 1.15E-12 4.66E-12 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 1.21E-07 8.57E-18 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 2.01E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 7.65E-06 NA mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 1.26E-06 4.15E-12 mr1011_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 7.71E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 1.11E-11 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 3.60E-21 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 8.98E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 2.85E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 4.00E-06 4.00E-06 mr1162_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 2.22E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 3.18E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 4.80E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 6.65E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 2.15E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 1.14E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 4.08E-09 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 3.07E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 1.72E-15 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 1.09E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 2.26E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 7.20E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 8.05E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208455296 NA 1.06E-20 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251