\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208048502:

Variant ID: vg1208048502 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8048502
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCTTCCTATCCAAGATTTCTAGACTTATCTCTAACGTAATCATCAGCAAACTCCTAGATTTCTAGAAATGTTGTATTTGAACGAAATGTTCTGTTTACC[A/G]
ATTTGTCTTGGTCGGTACCGTGCAGGCAGTAACCTGACCAAACCAGATTTGGCAACCAGGACACTTCGTATTCTCCTAAATGCCATAATTTCAGTAACTT

Reverse complement sequence

AAGTTACTGAAATTATGGCATTTAGGAGAATACGAAGTGTCCTGGTTGCCAAATCTGGTTTGGTCAGGTTACTGCCTGCACGGTACCGACCAAGACAAAT[T/C]
GGTAAACAGAACATTTCGTTCAAATACAACATTTCTAGAAATCTAGGAGTTTGCTGATGATTACGTTAGAGATAAGTCTAGAAATCTTGGATAGGAAGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 3.90% 1.04% 11.05% NA
All Indica  2759 92.10% 0.30% 0.62% 7.03% NA
All Japonica  1512 65.50% 11.60% 2.05% 20.77% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 89.40% 0.00% 0.00% 10.59% NA
Indica II  465 95.70% 0.00% 0.22% 4.09% NA
Indica III  913 92.10% 0.80% 1.42% 5.70% NA
Indica Intermediate  786 92.00% 0.00% 0.38% 7.63% NA
Temperate Japonica  767 80.60% 1.30% 1.30% 16.82% NA
Tropical Japonica  504 53.60% 28.40% 2.18% 15.87% NA
Japonica Intermediate  241 42.70% 9.50% 4.15% 43.57% NA
VI/Aromatic  96 94.80% 1.00% 0.00% 4.17% NA
Intermediate  90 85.60% 2.20% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208048502 A -> DEL N N silent_mutation Average:45.541; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg1208048502 A -> G LOC_Os12g14170.1 upstream_gene_variant ; 453.0bp to feature; MODIFIER silent_mutation Average:45.541; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg1208048502 A -> G LOC_Os12g14180.1 downstream_gene_variant ; 2303.0bp to feature; MODIFIER silent_mutation Average:45.541; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg1208048502 A -> G LOC_Os12g14170-LOC_Os12g14180 intergenic_region ; MODIFIER silent_mutation Average:45.541; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208048502 7.94E-07 1.50E-10 mr1016 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 9.38E-09 5.86E-12 mr1017 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 3.49E-06 NA mr1018 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 NA 6.61E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 1.50E-07 1.47E-10 mr1055 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 NA 2.39E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 NA 5.14E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 NA 2.38E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 6.82E-06 6.82E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 NA 2.56E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 1.03E-08 8.35E-12 mr1132 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 NA 1.46E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 NA 2.31E-06 mr1233 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 NA 3.68E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 2.34E-07 NA mr1390 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 NA 4.09E-07 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 2.76E-07 NA mr1490 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 2.95E-08 2.95E-08 mr1898 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 7.44E-07 NA mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 1.68E-07 NA mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 3.20E-06 NA mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048502 1.18E-07 NA mr1490_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251