\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207886389:

Variant ID: vg1207886389 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7886389
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.25, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:


GGGCCTCACGGTTCCCTGGTGGAGGAGTTCATTCTCCGACAGATTTGATTATTATTAATAAGATAAGGCTAAAAGGTGAAGTCTTATATGAAAATTGTTT[A/G]
GGACTATAATAATTAGAGGTTTCTTATAATAGCACTAACAGTTGAATTGTTTTTTTAACTGGTTATGAAAAAAAAAGAAAATGATTTTAAATCCATTATT

Reverse complement sequence

AATAATGGATTTAAAATCATTTTCTTTTTTTTTCATAACCAGTTAAAAAAACAATTCAACTGTTAGTGCTATTATAAGAAACCTCTAATTATTATAGTCC[T/C]
AAACAATTTTCATATAAGACTTCACCTTTTAGCCTTATCTTATTAATAATAATCAAATCTGTCGGAGAATGAACTCCTCCACCAGGGAACCGTGAGGCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 18.60% 17.10% 0.89% 63.37% NA
All Indica  2759 2.40% 3.80% 0.87% 92.97% NA
All Japonica  1512 50.30% 44.00% 1.06% 4.63% NA
Aus  269 1.50% 1.50% 0.00% 97.03% NA
Indica I  595 2.00% 0.70% 1.85% 95.46% NA
Indica II  465 3.40% 1.10% 0.43% 95.05% NA
Indica III  913 1.00% 5.60% 0.33% 93.10% NA
Indica Intermediate  786 3.60% 5.70% 1.02% 89.69% NA
Temperate Japonica  767 70.70% 22.30% 1.30% 5.74% NA
Tropical Japonica  504 29.00% 66.50% 0.60% 3.97% NA
Japonica Intermediate  241 30.30% 66.00% 1.24% 2.49% NA
VI/Aromatic  96 22.90% 8.30% 1.04% 67.71% NA
Intermediate  90 32.20% 28.90% 1.11% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207886389 A -> DEL N N silent_mutation Average:8.126; most accessible tissue: Callus, score: 28.972 N N N N
vg1207886389 A -> G LOC_Os12g13900-LOC_Os12g13910 intergenic_region ; MODIFIER silent_mutation Average:8.126; most accessible tissue: Callus, score: 28.972 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207886389 NA 1.26E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1207886389 2.50E-11 4.39E-11 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 1.93E-08 5.79E-16 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 5.18E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 3.34E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 2.47E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 3.50E-16 4.98E-16 mr1002_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 3.72E-12 3.20E-24 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 3.92E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 1.90E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 4.97E-09 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 2.93E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 4.25E-11 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 5.69E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 1.39E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 5.32E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 2.34E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 8.15E-09 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 4.62E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 3.84E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 1.21E-08 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 5.34E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207886389 NA 8.96E-08 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251