\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207840077:

Variant ID: vg1207840077 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7840077
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTGTTTTCATGTTATTAACAAAATTAATCATCTCCATATATGATTTGATATGTTACAAAGCGGTAGTGCTGCGGTAGTCGTGATCACCTTAGATGCCT[C/T]
AGACAAGATGCTTTGTCACGCATGCAAAAGGCAAAGGTGCATACGTGCATTGTGCAGCGGGCAAAAAAGAGAACTTCGGACGCTTTATTTATTAGCAAAT

Reverse complement sequence

ATTTGCTAATAAATAAAGCGTCCGAAGTTCTCTTTTTTGCCCGCTGCACAATGCACGTATGCACCTTTGCCTTTTGCATGCGTGACAAAGCATCTTGTCT[G/A]
AGGCATCTAAGGTGATCACGACTACCGCAGCACTACCGCTTTGTAACATATCAAATCATATATGGAGATGATTAATTTTGTTAATAACATGAAAACAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.90% 0.30% 2.18% 50.61% NA
All Indica  2759 23.60% 0.50% 3.30% 72.60% NA
All Japonica  1512 95.60% 0.00% 0.07% 4.37% NA
Aus  269 10.80% 0.40% 2.97% 85.87% NA
Indica I  595 26.40% 0.70% 5.88% 67.06% NA
Indica II  465 29.00% 0.40% 2.58% 67.96% NA
Indica III  913 17.90% 0.20% 2.74% 79.19% NA
Indica Intermediate  786 24.80% 0.90% 2.42% 71.88% NA
Temperate Japonica  767 94.40% 0.00% 0.13% 5.48% NA
Tropical Japonica  504 96.20% 0.00% 0.00% 3.77% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 31.20% 0.00% 0.00% 68.75% NA
Intermediate  90 67.80% 0.00% 3.33% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207840077 C -> DEL N N silent_mutation Average:12.091; most accessible tissue: Callus, score: 30.185 N N N N
vg1207840077 C -> T LOC_Os12g13850.1 downstream_gene_variant ; 4934.0bp to feature; MODIFIER silent_mutation Average:12.091; most accessible tissue: Callus, score: 30.185 N N N N
vg1207840077 C -> T LOC_Os12g13850-LOC_Os12g13860 intergenic_region ; MODIFIER silent_mutation Average:12.091; most accessible tissue: Callus, score: 30.185 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207840077 2.85E-06 3.06E-07 mr1041_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 8.98E-06 8.65E-06 mr1041_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 3.24E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 8.11E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 5.18E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 1.12E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 2.54E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 1.02E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 1.57E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 6.74E-06 8.93E-07 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 5.78E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 6.87E-06 mr1299_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 6.05E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 1.13E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 6.00E-06 2.60E-09 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 2.16E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 5.99E-06 1.97E-07 mr1420_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 3.67E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 4.27E-06 5.45E-07 mr1467_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 2.61E-08 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 3.91E-06 NA mr1494_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 8.12E-11 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 7.00E-06 mr1516_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 7.85E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 8.18E-06 9.92E-10 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 2.30E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 7.81E-14 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 7.23E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 7.44E-10 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 6.73E-07 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 7.21E-06 mr1700_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 2.00E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 1.18E-06 NA mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 2.17E-06 6.17E-06 mr1811_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 5.32E-06 NA mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 8.25E-07 6.70E-11 mr1824_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 2.46E-16 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 7.93E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 2.72E-09 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840077 NA 6.53E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251