\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206967731:

Variant ID: vg1206967731 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6967731
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GCCATTTTAATGTTGTGTGACAATAATTCAGAGCAAAAGACTGCCAAAGTTATAAACTATATATATCACAGTCTTTCACCGCTAATGATGGAGGCAAATA[G/T]
CAGCGGAGAGGATGGGTGCTTCACTGCTTCCTTTTTTTTTAGCAGTGTATGCTGTACTAGCAGCGCTTTGTTTGTTGCTGTCGCCGCCCCCGCTTCAATC

Reverse complement sequence

GATTGAAGCGGGGGCGGCGACAGCAACAAACAAAGCGCTGCTAGTACAGCATACACTGCTAAAAAAAAAGGAAGCAGTGAAGCACCCATCCTCTCCGCTG[C/A]
TATTTGCCTCCATCATTAGCGGTGAAAGACTGTGATATATATAGTTTATAACTTTGGCAGTCTTTTGCTCTGAATTATTGTCACACAACATTAAAATGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.00% 2.10% 2.86% 23.99% NA
All Indica  2759 90.10% 3.60% 3.48% 2.86% NA
All Japonica  1512 35.50% 0.10% 1.85% 62.57% NA
Aus  269 74.00% 0.00% 2.23% 23.79% NA
Indica I  595 82.00% 5.70% 10.92% 1.34% NA
Indica II  465 88.60% 8.40% 1.29% 1.72% NA
Indica III  913 96.90% 0.00% 0.11% 2.96% NA
Indica Intermediate  786 89.20% 3.20% 3.05% 4.58% NA
Temperate Japonica  767 41.30% 0.10% 1.17% 57.37% NA
Tropical Japonica  504 21.60% 0.00% 2.98% 75.40% NA
Japonica Intermediate  241 46.10% 0.00% 1.66% 52.28% NA
VI/Aromatic  96 79.20% 0.00% 1.04% 19.79% NA
Intermediate  90 64.40% 2.20% 4.44% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206967731 G -> DEL N N silent_mutation Average:87.734; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg1206967731 G -> T LOC_Os12g12640.1 upstream_gene_variant ; 511.0bp to feature; MODIFIER silent_mutation Average:87.734; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg1206967731 G -> T LOC_Os12g12650.1 upstream_gene_variant ; 3926.0bp to feature; MODIFIER silent_mutation Average:87.734; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg1206967731 G -> T LOC_Os12g12640-LOC_Os12g12650 intergenic_region ; MODIFIER silent_mutation Average:87.734; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1206967731 G T 0.0 0.0 0.01 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206967731 7.58E-08 5.85E-11 mr1038 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 1.62E-07 4.93E-11 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 NA 1.46E-06 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 6.60E-06 4.13E-08 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 NA 2.15E-07 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 NA 1.85E-09 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 NA 7.93E-07 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 NA 4.29E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 NA 8.56E-06 mr1227 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 1.64E-10 1.86E-14 mr1389 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 2.40E-09 3.79E-13 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 NA 8.95E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 NA 9.43E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 NA 2.71E-07 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 NA 1.95E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 NA 3.86E-07 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 1.14E-08 5.61E-14 mr1038_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 8.17E-08 1.29E-12 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 1.96E-07 NA mr1141_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 2.54E-07 1.50E-13 mr1141_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 NA 8.94E-08 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 NA 3.94E-07 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 NA 3.60E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 3.30E-09 5.12E-13 mr1389_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206967731 2.49E-08 1.91E-12 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251