Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206477744:

Variant ID: vg1206477744 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 6477744
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTAGATAACCCAGTTCTGTCCGAGAAGGACTCTTCCCATCTGTTGATTTCGTAAAGGTTTCCTTAGAATATACAGGAAATATCCGCGTACGCGTGGGTA[T/C]
GCCATGTCGATACGTAACGTATATCGAAGGGTAGAGGGTATGCCTGACCCGTAACCCTGACAGTAGCCCCCGACTTCTGCTCAAGATGAACTCGTGTGAC

Reverse complement sequence

GTCACACGAGTTCATCTTGAGCAGAAGTCGGGGGCTACTGTCAGGGTTACGGGTCAGGCATACCCTCTACCCTTCGATATACGTTACGTATCGACATGGC[A/G]
TACCCACGCGTACGCGGATATTTCCTGTATATTCTAAGGAAACCTTTACGAAATCAACAGATGGGAAGAGTCCTTCTCGGACAGAACTGGGTTATCTACG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.90%	3.00%	15.19%	40.88%	NA
All Indica	2759	37.10%	0.50%	17.69%	44.65%	NA
All Japonica	1512	39.90%	7.70%	10.65%	41.80%	NA
Aus	269	88.80%	0.40%	5.58%	5.20%	NA
Indica I	595	16.80%	0.00%	18.32%	64.87%	NA
Indica II	465	61.10%	0.40%	11.61%	26.88%	NA
Indica III	913	36.60%	1.00%	21.14%	41.29%	NA
Indica Intermediate	786	38.90%	0.50%	16.79%	43.77%	NA
Temperate Japonica	767	51.00%	0.50%	2.61%	45.89%	NA
Tropical Japonica	504	14.90%	20.40%	23.61%	41.07%	NA
Japonica Intermediate	241	56.80%	3.70%	9.13%	30.29%	NA
VI/Aromatic	96	27.10%	8.30%	43.75%	20.83%	NA
Intermediate	90	44.40%	4.40%	13.33%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206477744	T -> C	LOC_Os12g11890.1	upstream_gene_variant ; 457.0bp to feature; MODIFIER	silent_mutation	Average:24.114; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N
vg1206477744	T -> C	LOC_Os12g11900.1	downstream_gene_variant ; 4002.0bp to feature; MODIFIER	silent_mutation	Average:24.114; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N
vg1206477744	T -> C	LOC_Os12g11880-LOC_Os12g11890	intergenic_region ; MODIFIER	silent_mutation	Average:24.114; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N
vg1206477744	T -> DEL	N	N	silent_mutation	Average:24.114; most accessible tissue: Minghui63 root, score: 45.031	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206477744	NA	2.73E-09	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	2.60E-08	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	2.37E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	3.20E-06	NA	mr1368_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	3.66E-11	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	9.31E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	2.05E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	2.09E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	2.13E-08	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	6.52E-10	mr1552_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	1.27E-06	NA	mr1584_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	9.75E-06	4.74E-11	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	2.52E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	7.14E-08	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	1.93E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	6.51E-06	mr1852_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	4.97E-07	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	5.65E-09	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	4.78E-07	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	2.65E-07	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	5.16E-06	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	9.99E-08	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	1.07E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206477744	NA	1.16E-10	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251