\
| Variant ID: vg1202542327 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 2542327 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATAGACATCTTGACTATTGTGCTACTGTTTGTACCTTTAAGGCTTTAAACATGTCATTACCACTCCTGTATGATTTTCCCAGTCCAATTTTTTGAGTTCT[G/A]
TATGATTTTTTTTTTCAACTTTGAATACCCTTTGCTCAAATCCTGGATCCGTTACTATGGGTATCGTCAACATGTTTTGGGCAGGTACTATGACTCCTAA
TTAGGAGTCATAGTACCTGCCCAAAACATGTTGACGATACCCATAGTAACGGATCCAGGATTTGAGCAAAGGGTATTCAAAGTTGAAAAAAAAAATCATA[C/T]
AGAACTCAAAAAATTGGACTGGGAAAATCATACAGGAGTGGTAATGACATGTTTAAAGCCTTAAAGGTACAAACAGTAGCACAATAGTCAAGATGTCTAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.10% | 43.30% | 0.66% | 0.00% | NA |
| All Indica | 2759 | 92.60% | 6.30% | 1.09% | 0.00% | NA |
| All Japonica | 1512 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 11.20% | 88.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 0.30% | 1.18% | 0.00% | NA |
| Indica II | 465 | 93.10% | 6.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 91.10% | 7.20% | 1.64% | 0.00% | NA |
| Indica Intermediate | 786 | 89.70% | 9.40% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 65.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1202542327 | G -> A | LOC_Os12g05550.1 | upstream_gene_variant ; 4001.0bp to feature; MODIFIER | silent_mutation | Average:32.121; most accessible tissue: Callus, score: 45.242 | N | N | N | N |
| vg1202542327 | G -> A | LOC_Os12g05540.1 | downstream_gene_variant ; 3307.0bp to feature; MODIFIER | silent_mutation | Average:32.121; most accessible tissue: Callus, score: 45.242 | N | N | N | N |
| vg1202542327 | G -> A | LOC_Os12g05540-LOC_Os12g05550 | intergenic_region ; MODIFIER | silent_mutation | Average:32.121; most accessible tissue: Callus, score: 45.242 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1202542327 | NA | 2.61E-18 | mr1131_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202542327 | NA | 9.24E-06 | mr1131_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202542327 | NA | 1.34E-17 | mr1199_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202542327 | NA | 9.38E-06 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202542327 | NA | 5.47E-06 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202542327 | NA | 1.95E-07 | mr1404_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202542327 | NA | 4.07E-06 | mr1482_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202542327 | NA | 9.36E-07 | mr1620_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202542327 | NA | 2.53E-09 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |