\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202542327:

Variant ID: vg1202542327 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2542327
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGACATCTTGACTATTGTGCTACTGTTTGTACCTTTAAGGCTTTAAACATGTCATTACCACTCCTGTATGATTTTCCCAGTCCAATTTTTTGAGTTCT[G/A]
TATGATTTTTTTTTTCAACTTTGAATACCCTTTGCTCAAATCCTGGATCCGTTACTATGGGTATCGTCAACATGTTTTGGGCAGGTACTATGACTCCTAA

Reverse complement sequence

TTAGGAGTCATAGTACCTGCCCAAAACATGTTGACGATACCCATAGTAACGGATCCAGGATTTGAGCAAAGGGTATTCAAAGTTGAAAAAAAAAATCATA[C/T]
AGAACTCAAAAAATTGGACTGGGAAAATCATACAGGAGTGGTAATGACATGTTTAAAGCCTTAAAGGTACAAACAGTAGCACAATAGTCAAGATGTCTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 43.30% 0.66% 0.00% NA
All Indica  2759 92.60% 6.30% 1.09% 0.00% NA
All Japonica  1512 2.10% 97.90% 0.00% 0.00% NA
Aus  269 11.20% 88.80% 0.00% 0.00% NA
Indica I  595 98.50% 0.30% 1.18% 0.00% NA
Indica II  465 93.10% 6.70% 0.22% 0.00% NA
Indica III  913 91.10% 7.20% 1.64% 0.00% NA
Indica Intermediate  786 89.70% 9.40% 0.89% 0.00% NA
Temperate Japonica  767 3.30% 96.70% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 33.30% 65.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202542327 G -> A LOC_Os12g05550.1 upstream_gene_variant ; 4001.0bp to feature; MODIFIER silent_mutation Average:32.121; most accessible tissue: Callus, score: 45.242 N N N N
vg1202542327 G -> A LOC_Os12g05540.1 downstream_gene_variant ; 3307.0bp to feature; MODIFIER silent_mutation Average:32.121; most accessible tissue: Callus, score: 45.242 N N N N
vg1202542327 G -> A LOC_Os12g05540-LOC_Os12g05550 intergenic_region ; MODIFIER silent_mutation Average:32.121; most accessible tissue: Callus, score: 45.242 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202542327 NA 2.61E-18 mr1131_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327 NA 9.24E-06 mr1131_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327 NA 1.34E-17 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327 NA 9.38E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327 NA 5.47E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327 NA 1.95E-07 mr1404_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327 NA 4.07E-06 mr1482_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327 NA 9.36E-07 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327 NA 2.53E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251